MG_221 – mraZ protein

Name
WID MG_221 View in model
Name mraZ protein View in model
Symbol mraZ
Protein product MG_221_MONOMER
Cross references GenBank: AAC71442.1, CMR: MG_221, BioCyc: MG_221, SwissProt: P47463
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 264166269592 MG_218 MG_219 MG_221 MG_222 MG_223 MG_224 MG_491 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 266666 (nt), Length: 426 (nt), Direction: Forward, G/C content: 35.0%, Sequence:
1
51
101
151
201
251
301
351
401
ATGCTGCTAGGTACCTTTAATCTTACCCTTGATAACAAGAACAGAATTAG
CTTGCCAGCTAAGCTCCGTAGTTTCTTTGATAGCAGCATAGTTATTAACC
GCGGCTTTGAAAACTGTTTGGAAATTAGAAAACCTGCAGACTTTGAGAGT
TATTTTCAAACCTTTAATAACTTCCCTAACACCCAAAAAGACACAAGAAC
ATTAAAACGCTTAATCTTTGCTAATGCTAATCTAGTTGAACTTGATAGTG
CAAACAGAATCCTAATCCCTAATAACCTAATTAGTGATGCTAAGTTAGAT
AAAGAGATCGTGTTAATTGGTCAATTTGACCATCTTGAAGTTTGGGATAA
AGTGCAATATGAACAATATCTAGCTAGTTCAGAATCACTAGAGACAGTAG
CTGAAAGGATGAAAGATGCTAAATAA
50
100
150
200
250
300
350
400
426
View in model
Transcription unit TU_147 View in model
Empirical formula (pH 7.5) H4562C4135N1755O2956P426
Molecular weight (pH 7.5; Da) 139333.11 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
3.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4356500
pI 3.83
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:11