MG_220

Name
WID MG_220 View in model
Protein product MG_220_MONOMER
Cross references GenBank: AAC71441.1, CMR: MG_220, BioCyc: MG_220, SwissProt: Q49403
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 263575268857 MG_218 MG_219 MG_220 MG_221 MG_222 MG_223 MG_491 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 266075 (nt), Length: 282 (nt), Direction: Reverse, G/C content: 34.0%, Sequence:
1
51
101
151
201
251
ATGTATAAATTAGAAAAAGCACAAGCTAAGCAAGTTGTTGGTGGATTATC
TTTCTGAACTTTTAGTGCAGGACTTATTATGATAGTTAATGCACTTACTG
GGGTTGCACATGCAGTAAATGACATTTTTCAAAGTACCACAGCTAATGCC
AATGGTTCTGATGATGATAATGAGAATAAAAATAATAGTTATCGCTCTAA
AAGCAATTACTTTAACACCGCACGGTTTAAACTAGGATTAACCCCAGGTA
GTTCTTCCTATTCCTTTCCAGTTTTTAGTTAA
50
100
150
200
250
282
View in model
Transcription unit TU_145 View in model
Empirical formula (pH 7.5) H3010C2727N1131O1975P282
Molecular weight (pH 7.5; Da) 91961.96 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2870900
pI 4.07
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:11