MG_218 – high molecular weight cytadherence accessory protein 2

Name
WID MG_218 View in model
Name high molecular weight cytadherence accessory protein 2 View in model
Symbol hmw2
Protein product MG_218_MONOMER
Cross references GenBank: AAC71437.1, CMR: MG_218, BioCyc: MG_218, SwissProt: P47460
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 256677267095 MG_217 MG_218 MG_491 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 259177 (nt), Length: 5418 (nt), Direction: Forward, G/C content: 34.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
2951
3001
3051
3101
3151
3201
3251
3301
3351
3401
3451
3501
3551
3601
3651
3701
3751
3801
3851
3901
3951
4001
4051
4101
4151
4201
4251
4301
4351
4401
4451
4501
4551
4601
4651
4701
4751
4801
4851
4901
4951
5001
5051
5101
5151
5201
5251
5301
5351
5401
ATGAAACCATTTGATAAAAAACCTTCGCTGCAACCAATTTATGACATTGG
TTTTGATGATGGTTATCTCCAAAGTGAGTATGAAAAAAATCGTTCTAAAA
CCGATGTTGATAAGATCGAAAACCAGCTTTTAAAAGAGATTAAAAGCCTG
GAAGATGAACTTAAAAACCTTAAGGGCTTGAAGAATCAAGCAGAAGATAA
TCCTGAACTTGATAAAAAGATTAACCACTTGGAAGTTGATCTAAACCGTT
TGGTTAATGAATATAAAAACTTCCAGTTCCAAAAGAACCACATGGTTGAT
AAGGTTAGTGAACTTGATAACTTAACCCGTTTTTATAAGAATGAACTAAC
CCGCTTACAACAAGAAAACGCTGATTTTCTCAACTCCAAGTATGCTAATT
TAGCTAACTTCCAAGCTAACTACCACAATAAACTAAATGATTTTCACCGC
TTAATAGAAAATCAAAACCAAACCATTAACCGCTTAAACCAAAAGATTAA
TGGTAACCAAAATCTGATTGATAATAACGTTGCTTTACTGCAAAACCCCA
ACATCACAGTTGAAAAAAAGAACTACTTACTAAATGTTATTGATCAACTT
TACAATGAGCTTGATCAACTTGAGAATCAAAAAAGATTATTAAGTATTGA
GTATGAAAATACCTATAGAGAGTTAGTTAGTGCAGATAATGAACTGCAAA
ATGTTTATGAAAACATCGATCAAAATCAGATCCAGTTTAAACACCAATAC
CAAACTTATAGAGATGAGTTAAGTCAACTTGAGCGCAAGATCCAGCTCAC
CAAACAAGAGTTAGTTGATAAAGAATCAGCACTAAGAGTAAAGATAGATG
ATGCTGATTTTTACATTAATGCCCGTTTAGCTGAACTTGATGATGTAGCT
AAACAACTTAGCTTTCAAGATGGTATTACCAAGCAAAATGCTCAACATGT
TGAGGATAAGTTAGTTGCTTTAAACAAAGAAAAAGACCGTTTAAATACCC
AAAAAGAGGCCTTTTTTAACTTAAGACAATCTGCTTTAATTGATATCAAT
AAACTCCAGCAGGAAAATGAACTGTTTGCTAAGCACTTAGAACACCAGCA
AAATGAGTTTGAACAAAAACAGTCTGATAGCCTCTTAAAGCTTGAAACTG
AATATAAGGCTTTACAACACAAGATTAATGAATTTAAAAATGAAAGTGCC
ACTAAGAGCGAGGAACTTTTAAACCAAGAACGGGAACTATTTGAAAAACG
CAGGGAAATTGACACGCTTTTAACCCAAGCATCTTTGGAATATGAACACC
AACGTGAGTCAAGTCAACTACTCAAAGATAAGCAGAATGAAGTAAAACAA
CACTTCCAAAACTTAGAGTATGCTAAAAAGGAGCTAGACAAAGAAAGAAA
CCTCTTAGATCAACAAAAAAAAGTTGATAGTGAAGCAATCTTTCAACTCA
AAGAAAAGGTTGCTCAAGAACGTAAGGAGCTTGAAGAACTATACCTTGTT
AAAAAACAAAAACAAGATCAGAAGGAAAATGAACTGTTGTTTTTTGAAAA
GCAGTTAAAACAACACCAAGCAGATTTTGAAAATGAATTGGAAGCTAAAC
AACAGGAGTTGTTTGAAGCTAAACATGCATTGGAACGTTCCTTTATCAAA
CTTGAAGATAAAGAAAAAGATCTTAACACTAAAGCACAACAGATTGCCAA
TGAGTTTTCCCAACTAAAAACTGATAAGTCAAAGAGTGCTGATTTTGAAC
TAATGTTGCAAAATGAGTATGAAAACTTGCAACAAGAAAAACAAAAGTTA
TTCCAAGAACGTACTTACTTTGAAAGGAATGCTGCGGTTTTATCAAACCG
GTTACAACAAAAACGTGAGGAGTTATTACAACAAAAAGAAACGCTTGATC
AGCTTACAAAAAGCTTTGAGCAAGAACGGTTAATCAACCAAAGGGAACAC
AAGGAGTTGGTTGCATCAGTTGAAAAACAAAAGGAGATATTGGGCAAAAA
ACTCCAAGATTTTTCCCAAACTTCACTGAACGCTTCTAAAAATTTAGCTG
AACGGGAGATGGCAATCAAGTTTAAAGAAAAGGAGATAGAAGCAACTGAA
AAGCAACTGTTAAATGATGTTAATAATGCTGAAGTTATCCAAGCAGACTT
AGCACAACTCAACCAATCACTTAACCAAGAACGCAGTGAATTGCAAAACG
CCAAACAAAGGATTGCTGATTTTCACAATGATTCACTAAAAAAACTCAAT
GAGTATGAACTTAGCTTACAAAAACGGTTGCAAGAATTACAAACCCTTGA
GGCTAACCAAAAACAACATTCATATCAAAATCAAGCTTACTTTGAAGGTG
AACTTGATAAACTTAACAGAGAAAAACAAGCTTTTTTGAACTTACGTAAG
AAACAAACTATGGAGGTTGATGCTATTAAACAAAGGTTGAGTGATAAACA
TCAAGCTTTAAATATGCAACAAGCAGAGCTAGATAGAAAAACCCATGAGT
TAAATAATGCTTTTTTAAACCATGATGCGGATCAAAAGAGTCTACAGGAC
CAACTAGCAACTGTTAAAGAGACCCAAAAACTAATTGATTTAGAACGTAG
TGCACTGCTTGAAAAGCAACGTGAGTTTGCTGAAAATGTTGCTGGTTTTA
AGCGCCATTGGTCTAATAAAACTAGTCAACTCCAAAAGATTTATGAACTG
ACCAAAAAACAGGAAAGTGAGCAAACCCAAAAGGAAACAGAACTAAAGAT
TGCTTTTAGTGATCTACAAAAAGACTATCAGGTTTTTGAACTCCAAAAGG
ACCAAGAATTTAGACAAATTGAAGCTAAGCAACGTGAACTTGACAAGTTA
GCTGAAAAAAATAATCAGGTCAAACTAGAACTTGATAACAGGTTTCAAGC
GCTGCAAAACCAAAAGCAAGACACAGTACAAGCTCAGCTAGAACTGGAAC
GTGAACAACACCAGTTAAACCTTGAGCAAACTGCTTTCAACCAAGCTAAT
GAATCACTTTTAAAACAACGTGAACAACTCACCAAAAAGATCCAAGCTTT
CCACTATGAGTTGAAAAAGCGTAACCAATTCTTAGCTTTAAAAGGGAAAA
GGTTGTTTGCAAAAGAGCAAGATCAACAACGCAAAGATCAGGAGATCAAC
TGACGCTTTAAACAGTTTGAAAAGGAATATACTGATTTTGATGAAGCTAA
GAAAAGGGAACTTGAAGAGCTTGAAAAGATCAGAAGAAGTTTAAGTCAAA
GCAACGTTGAATTAGAGAGAAAAAGAGAAAAACTGGCTACTGATTTCACT
AATTTAAATAAGGTTCAACACAACACCCAAATTAACCGTGATCAACTTAA
CAGTCAGATCAGACAGTTCTTATTAGAACGCAAAAACTTCCAACGCTTTA
GTAATGAAGCTAATGCTAAAAAAGCCTTTTTAATTAAGCGCTTAAGAAGC
TTTGCATCCAATCTAAAACTCCAAAAAGAAGCGTTAGCAATCCAAAAACT
AGAGTTTGATAAGCGTGATGAACAACAGAAAAAAGAGTTACAGCAAGCTA
CTTTACAACTAGAACAGTTCAAGTTTGAAAAGCAAAACTTTGACATTGAA
AAACAACGCCAACTAGTTGCTATTAAAACTCAGTGTGAAAAACTTAGTGA
TGAAAAAAAGGCACTAAACCAAAAGCTAGTTGAACTAAAAAACTTATCCC
AAACCTATCTTGCTAATAAGAATAAGGCTGAATACTCCCAGCAACAACTC
CAACAGAAATACACCAATTTACTTGATCTGAAGGAAAACTTAGAGAGAAC
CAAAGATCAATTAGATAAAAAACATCGTTCTATCTTCGCTAGATTAACTA
AGTTTGCAAATGACTTACGTTTTGAAAAAAAGCAACTGTTAAAAGCACAG
CGCATAGTTGATGATAAAAACCGTCTTTTGAAAGAAAATGAACGTAACCT
CCATTTCCTTTCCAATGAAACAGAACGAAAACGAGCAGTTCTCGAAGATC
AAATTTCTTACTTTGAAAAACAACGTAAACAAGCTACTGATGCGATCCTA
GCATCACATAAAGAAGTTAAAAAGAAGGAAGGTGAACTGCAAAAGTTACT
GGTTGAATTAGAAACAAGAAAAACCAAACTCAACAATGATTTTGCAAAAT
TCTCAAGACAACGTGAAGAGTTTGAAAACCAACGCTTAAAGCTCTTGGAA
CTGCAAAAAACCCTGCAAACCCAAACTAATTCCAACAACTTTAAAACCAA
AGCAATCCAAGAGATTGAAAACAGTTATAAAAGGGGGATGGAAGAACTTA
ACTTCCAAAAGAAGGAGTTTGATAAGAATAAATCACGCTTATATGAATAC
TTTAGAAAGATGCGTGATGAGATTGAAAGAAAGGAAAGTCAGGTTAAGTT
AGTTTTAAAAGAGACCCAAAGGAAAGCCAACCTCTTAGAAGCACAAGCCA
ACAAACTTAACATTGAAAAAAACACTATTGACTTTAAAGAAAAAGAGTTA
AAAGCCTTTAAAGATAAGGTTGATCAAGACATTGATTCAACCAATAAACA
ACGCAAGGAGTTAAATGAGCTTTTAAATGAAAACAAGTTATTACAACAAT
CACTAATCGAAAGAGAAAGGGCTATTAATTCCAAAGATTCACTTCTAAAT
AAGAAGATAGAAACGATTAAACGCCAACTCCATGATAAGGAGATGCGGGT
GTTGCGCTTGGTTGATAGAATGAAATTAGCAGAACAGAAATACCAAACAG
AAATCAACCGCTTAAGAACCCAAACTTTCGATTCTGAAAAACAAGACATT
AAAAACTTCTTCCCACCGTTATTTAAAATTAACGGTAATGATATGGCCTT
TCCTTACTTGTACCCCTGACTATATCCTCAACAAAAGCAAGATGATAATA
CTCTGCAAATTCGTCAGCTTTTTGAACAGCAGCTGCAGTTCATGCAACAA
CGCTATGAAAATGAGTTAAATGAATTGCGTAGACAACGTAATTTACTTGA
GAAAAAACTTGATCAAATCCAACTAGAATCCCAACTTAATAATAAGCAAA
GTGAGTTTAGTAAGGTGGAATCAATGATGGAAAAACTACTTGAAAAAACT
GAGAGTAGGTTAAATGATTTTGATCAGAAAATTAACTATCTCACCAAGAA
AGTTAACCAACACAACACCTATCAACCAAGTTCCTATCAACCAACTCCTT
CTTATCAAGACAGTGATAAACAACAGTTGTTATTTAGAATCCAAGAACTG
GAAAAACAAAACTTATTCCAACAACAATTTCAACCTGCACCAGCTGTTGT
CCAACAACCTACTAGTTTTGCAGCCCCTAACATCACCAAACAACAGCAAA
TTGCCCAACTTAATGCTGAAATTAACAACATTAAAAGGTTGATTGCCCAA
AAAGCAGCAAGTAAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2150
2200
2250
2300
2350
2400
2450
2500
2550
2600
2650
2700
2750
2800
2850
2900
2950
3000
3050
3100
3150
3200
3250
3300
3350
3400
3450
3500
3550
3600
3650
3700
3750
3800
3850
3900
3950
4000
4050
4100
4150
4200
4250
4300
4350
4400
4450
4500
4550
4600
4650
4700
4750
4800
4850
4900
4950
5000
5050
5100
5150
5200
5250
5300
5350
5400
5418
View in model
Transcription unit TU_143 View in model
Empirical formula (pH 7.5) H58302C52883N23199O36953P5418
Molecular weight (pH 7.5; Da) 1777907.74 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
56412000
pI 3.51
 
Comments
Comments required for property function of adhesins, may help localize adhesins to tip organelle, part of the cytoskeleton-like Triton shell [PUB_0088]; protein not detectable in M. genitalium [PUB_0091]; homologous to the filamentous coiled-coil portion of myosin type II heavy chain [PUB_0093]; high Pro content, low pI, central acidic Pro-rich domain [PUB_0089]; required for gliding [PUB_0091]; Pich et al showed that MG_218 codes for two proteins -- HMW2 and HMW2-s [PUB_0803]; the M. pneumoniae homolog has also been showed to code for two proteins [PUB_0804]. Pich et al also showed that MG_218 knockouts exhibit reduced gliding motility and that the MG_218 N-terminus is required for proper terminal organelle architecture [PUB_0803].
References
  1. Balish MF, Krause DC. Mycoplasmas: a distinct cytoskeleton for wall-less bacteria. J Mol Microbiol Biotechnol 11, 244-55 (2006). WholeCell: PUB_0091, PubMed: 16983199

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Boonmee A, Ruppert T, Herrmann R. The gene mpn310 (hmw2) from Mycoplasma pneumoniae encodes two proteins, HMW2 and HMW2-s, which differ in size but use the same reading frame. FEMS Microbiol Lett 290, 174-81 (2009). WholeCell: PUB_0804, PubMed: 19025563

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Krause DC. Mycoplasma pneumoniae cytadherence: organization and assembly of the attachment organelle. Trends Microbiol 6, 15-8 (1998). WholeCell: PUB_0093, PubMed: 9481818

  6. ... 4 more

  7. Pich OQ, Burgos R, Ferrer-Navarro M, Querol E, Piñol J. Role of Mycoplasma genitalium MG218 and MG317 cytoskeletal proteins in terminal organelle organization, gliding motility and cytadherence. Microbiology 154, 3188-98 (2008). WholeCell: PUB_0803, PubMed: 18832324

  8. Proft T, Hilbert H, Plagens H, Herrmann R. The P200 protein of Mycoplasma pneumoniae shows common features with the cytadherence-associated proteins HMW1 and HMW3. Gene 171, 79-82 (1996). WholeCell: PUB_0089, PubMed: 8675035

  9. Razin S, Jacobs E. Mycoplasma adhesion. J Gen Microbiol 138, 407-22 (1992). WholeCell: PUB_0088, PubMed: 1593256

  10. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:11