MG_217 – P65 adhesin

Name
WID MG_217 View in model
Name P65 adhesin View in model
Symbol p65
Protein product MG_217_MONOMER
Cross references GenBank: AAC71436.1, CMR: MG_217, BioCyc: MG_217, SwissProt: P47459
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 255541261660 MG_216 MG_217 MG_218 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 258041 (nt), Length: 1119 (nt), Direction: Forward, G/C content: 34.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
ATGGAAAAAAATAGATCAGCTTTTCAACAAAACCAACAAGCATCAAACCA
ACCTTTTAACCAAGATCAAAACCAGTATTACCAAGATCCTAACCAACAAC
AATTTAACCAATCTGGTTTTGATCCAAATCAACAGCAATTTAATCAACCA
GGATTTGATCCTAACCAACAATATTATCAAGATCCCAATCAACAACAATT
TAATCAAGCTGGTTTTGATCAAAACCAACAGTATTACCAAGATCCCAATC
AACAGCAATTTAATCAACCAGGATTTGATCCTAACCAACAATATTATCAA
GATCCCAATCAACAACAATTTAATCAAGCTGGTTTTGATCAAAACCAGTA
TTACCAAGATCCTAACCAACAACAATTTAACCAATCTGGTTTTGATCAAA
ACCAGTACTATCAAGATCCTAATCAGCAACAATTTAACCAGCCTAGTTTT
GATCTAAATAACCAACAATTTAACCAACCTGGATTCAACCAATCCCCAGC
ATTTGAAATCACACCTCAAGAGCAAAAAGCTGAACAGGAAATGTTTGGTG
AAGAACCACCTCAAGTAGTTAGAGAGATCCATGAACTACCATTTGAAAAG
ATCCGTTCTTTTTTACAAAGTGATTTTGATAGCTATAACTTTCGCTTAAA
CTCACTTAAAAGCAAACTGGATAATGCCTTGTATTCACTTGATAAAACAA
TCCAAAACACCAATGAAAACACTGCTAATCTAGAAGCAATTAGACATAAC
TTAGAACAAAAGATTCAAAACCAAAGCAAGCAATTAAGAACTAACTTTGA
TACCCAAAAGCTTGATGATAAGATCAATGAATTGGAGATCAGAATGCAAA
AACTAACCAGGAATTTTGAATCTCTAAGTGAACTTTCAAAGCACAACTCT
TATCCTAATTACTATGAAAAATTGTTACCAAATGGTGGTGATAGTATGAC
CAATGTCTTTGAAAAAGCACTAATGATGAATTTATTGAGAACTACATTAC
CCCCTCAACCCCAAGTTCAATACTACCCTCAACCCTATCCATACATAAGA
CCTTACTATGATGAACCTATTTACGCTGGGTTTAGAAGAAGGGGTTACCG
TGATGACTTCTATGAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1119
View in model
Transcription unit TU_142 View in model
Empirical formula (pH 7.5) H12021C10901N4728O7674P1119
Molecular weight (pH 7.5; Da) 366707.36 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
11464500
pI 3.57
 
Comments
Comments required for adhesion and terminal organelle [PUB_0092]; may be directly involved in adhesion [PUB_0405];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Krause DC. Mycoplasma pneumoniae cytadherence: unravelling the tie that binds. Mol Microbiol 20, 247-53 (1996). WholeCell: PUB_0405, PubMed: 8733224

  4. Regula JT, Boguth G, Görg A, Hegermann J, Mayer F, Frank R, Herrmann R. Defining the mycoplasma 'cytoskeleton': the protein composition of the Triton X-100 insoluble fraction of the bacterium Mycoplasma pneumoniae determined by 2-D gel electrophoresis and mass spectrometry. Microbiology 147, 1045-57 (2001). WholeCell: PUB_0092, PubMed: 11283300

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:10