MG_214 – segregation and condensation protein B

Name
WID MG_214 View in model
Name segregation and condensation protein B View in model
Symbol scpB
Protein product MG_214_MONOMER
Cross references GenBank: AAC71433.1, CMR: MG_214, BioCyc: MG_214, SwissProt: P47456
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 251479257103 MG_212 MG_213 MG_214 MG_215 MG_216 MG_482 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 253979 (nt), Length: 624 (nt), Direction: Forward, G/C content: 35.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGAAAACAACAATTAATATTGCCACCCCTACCCTAAAAAAACCTAGCAA
AGAAGCTAACTTGGTTGCTAGTATCTATGGGTTGTTATTTGTTTGTGGCG
CGAAAGGGATCACTTTAAGAGAACTAATTAGGATCTTTAAAAAAGCAGGG
ATTGAAAAGGTGAAATTAGCACTCTTAGCACTTGAAAGGAAGTTAGCAGA
TGATGAGCAATCAGGAGTGGAGTTGAAAAAATTTGGTAATAGTTTTTCTT
TGGTAACAAAACCAATTATCAAAGACTATCTCCACTTATTATTGGCTCAT
AAAGTCAAAAATCCCCTTAATTCCAAAGCAATGGAAGTGTTGGCTATCAT
TGCTTACAACCAACCTTGCACCAGACCCAGAATTAATGAAATTAGGGGAG
TTGATTCTTTTCAAATTGTTGATGATCTAATAGCAAAAGAGTTAATTGTG
GAGTTAGGGAGAACTGATAAACCAGGTCGACCTTTTATTTATGAAGTGTC
AGCTAAGTTCTATGATTTATTTGGCATTGATAGCTTAGATCAACTCCCTA
AGATTGAGCATTTTGATCTTGATAAATTTAAGCAAGGTAGCTTTTTTGAT
TCCAACCGCTATGGTGATGAATAA
50
100
150
200
250
300
350
400
450
500
550
600
624
View in model
Transcription unit TU_132 View in model
Empirical formula (pH 7.5) H6673C6048N2544O4348P624
Molecular weight (pH 7.5; Da) 203892.52 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6412300
pI 3.95
 
Comments
Comments in B. subtilis forms a complex with scpB and smc (scpA:scpB:smc::1:2:2) [PUB_0337];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Mascarenhas J, Volkov AV, Rinn C, Schiener J, Guckenberger R, Graumann PL. Dynamic assembly, localization and proteolysis of the Bacillus subtilis SMC complex. BMC Cell Biol 6, 28 (2005). WholeCell: PUB_0337, PubMed: 15987505

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:10