MG_212 – 1-acyl-sn-glycerol-3-phosphate acyltransferase, putative

Name
WID MG_212 View in model
Name 1-acyl-sn-glycerol-3-phosphate acyltransferase, putative View in model
Symbol plsC
Protein product MG_212_MONOMER
Cross references GenBank: AAC71431.1, BioCyc: MG_212, CMR: MG_212, SwissProt: Q49402
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 249281255088 MG_210 MG_211 MG_212 MG_213 MG_214 MG_215 MG_480 MG_482 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 251781 (nt), Length: 807 (nt), Direction: Forward, G/C content: 32.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGGATAAACTATTTAAAACAAGTTTTAGATTCATAATAAGGTTTTTACA
AATCCTGAGTTTACCAGTTGTTTTTCCTTACTTTTTATTAAGCTTTTTAG
CTTGTTTAATTACTAGTAAAAACTATGAATCACTCCCTTATAACTATCCC
CCTGAAATCCGATTCAAAAAGGTGTATAGATTGGTATCAATGTGACTTTA
CATTAAGGGAATTAAAGTAGTGACAGTAAATGACAAGATTATCCCTAAAA
AACCAGTTTTAGTGGTAGCTAACCACAAATCTAACCTTGATCCTTTAGTA
TTAATTAAGGCCTTTGGCAGGTTGAAAAATAGTCCACCATTAACCTTTGT
TGCTAAGATTGAACTGAAAGATACAGTCCTTTTTAAACTGATGAAATTAA
TTGATTGTGTTTTTATTGATCGAAAAAACATCAGACAAATTGCCAATGCA
TTGGAAACCCAACAACAACTAATTCGCCAGGGCACTGCTATTGCTGTTTT
TGCTGAAGGGACTAGGATTTTAAGTAATGACATTGGGGAATTTAAACCAG
GAGCACTAAAGGTTGCTTACAATGCTTTTGTACCTATCTTACCAGTTAGT
ATTGTGGGTAGCTTAGGAAAGATGGAATCAAACAAAAGGCTAAAAGAACA
TGGTGTTAAGAAAAGTTCAAACTATGAGGTTAAAGTAATCTTTAACAAGC
TAATTAACCCAATTAGTTTTAACCAGATTGATTCTAATAACCTTGCTAAT
AACATTAGAAGCATTATTAGTGATGCATACACTAGTGAAAAACCAAGCAA
TGATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
807
View in model
Transcription unit TU_131 View in model
Empirical formula (pH 7.5) H8618C7810N3255O5623P807
Molecular weight (pH 7.5; Da) 263041.94 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8334900
pI 3.97
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:10