MG_210 – prolipoprotein signal peptidase, signal peptidase II

Name
WID MG_210 View in model
Name prolipoprotein signal peptidase, signal peptidase II View in model
Symbol lspA
Protein product MG_210_MONOMER
Cross references GenBank: AAC71428.1, CMR: MG_210, BioCyc: MG_210, SwissProt: Q49401
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 246903252449 MG_206 MG_207 MG_208 MG_209 MG_210 MG_211 MG_212 MG_480 MG_482 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 249403 (nt), Length: 546 (nt), Direction: Reverse, G/C content: 29.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGAAATTAAGAAAAACCAAGTTTTTTTCACAACTTAAACACCAGGTTTT
AACTGCAAACCAAAAACCATTTTTATTCTATAAACTGACAATGATTGGGT
TTGTTGGCTTTATTATCTTACTGCAAGTTTTCATATTAAGAAATGCGTTA
AATGGTGAGATGGATAACACCATGGTAGCAAATAGTGGTTTTATTAATAT
CTATGTGATTAGAAACAAAGGGGTAGGGTTTAGCTTATTACAAAACCAAA
CTGGCTTAGTTTACTTTCTCCAGGGATTATTATCAGTAATTGCGTTAGTT
TTTCTTGTTTTTATGGTGAAATATAGTTACATCTTTTGAATTACAACTTT
AGCATTTGGTTCACTTGGAAACTTCTTTGATCGTTTAACTTCAGCTAATG
ATTCAGTGTTAGATTACTTTATCTTTCAGAATGGTAGTTCAGTATTTAAC
TTTGCTGATTGTTGTATTACCTTTGGTTTTATAGGTTTATTCTTTTGTTT
TTTAATCCAGATGTTCAAAGAGTTTAAACATTCCAAAAACCAGTAA
50
100
150
200
250
300
350
400
450
500
546
View in model
Transcription unit TU_128 View in model
Empirical formula (pH 7.5) H5790C5243N2079O3873P546
Molecular weight (pH 7.5; Da) 176805.14 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5595400
pI 4.79
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:09