MG_209 – 23S rRNA pseudouridine synthase; U955, U2504, U2580

Name
WID MG_209 View in model
Name 23S rRNA pseudouridine synthase; U955, U2504, U2580 View in model
Symbol yceC
Synonyms rluA, rluC
Protein product MG_209_MONOMER
Cross references GenBank: AAC71427.1, CMR: MG_209, BioCyc: MG_209, SwissProt: P47451
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 245977251904 MG_206 MG_207 MG_208 MG_209 MG_210 MG_211 MG_480 MG_482 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 248477 (nt), Length: 927 (nt), Direction: Reverse, G/C content: 34.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
ATGAAACAGTGTTTTGTTGTTACAACTACCAAACGCTTAGATAGTCTTTT
AGCTAGCTTACTGAACCTTTCAAGAGTAAAGGTAGTGAAGCTGATCATGA
ATGGACAGATTAAAGTTAATGAAAAACTAACTTTTAAAAACAGTTTAATA
GTTGCAAAAGATGATGTAATTAAAGTTGAGATTCATGATGAGACAACTAG
TGATTTCATTACTAGTGTTGAACCTTATAACTTAAAGCTTGAGGTTCTTT
TTGAAGACAAGGATTTGATGGTTATTAACAAACCATCAGGTTTGTTAACC
CATCCCACCACTTTCAATGAAAAAGCCAGCTTGTTAGCTGCTTGTATCTT
TCACAACAACAAAAACCCTGTTTACTTAGTGCACAGATTGGACCGTGATA
CTAGTGGGGCAATTGTTGTCTGTAAAAACCAAGCAAGCTTATTAAATTTG
CAAAATCAACTGCAAAATCGCACCTTAAAACGTTATTATGTAGCACTAGT
CCACTTCCCTTTTAATGCCTTAACTGGTTCAATTAATGCACCTTTAGCAA
GGGTTAATAACAACAAGGTAATGTTTAAAATAGCCCAAACTGCTAAAGCA
AAGCAAGCAATAACTAAGTTTAAAGTGATTAATCAGAATGAAAAAGCAGC
ACTAATTAGCTTGGAATTGTTAACAGGTAGAACCCACCAAATTAGAGTGC
ATCTGAAATTTATCCAACATCCAGTTTATAATGATCCACTGTATGGAATT
AAAAGTGAAAAGAAAGATAGCTATGGTCAGTTTCTCCATGCAAACAGGAT
CTGTTTTATCCATCCCACTTTAAACAAACCTATGGACTTTCACGCCCCAC
TTGAACCTAAGTTTTCAACGAAACTTAAGAGTTTAAACTTATCTTTAACC
GATCCACTCCATGTTCTTTTTAAGTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
927
View in model
Transcription unit TU_128 View in model
Empirical formula (pH 7.5) H9917C8989N3792O6443P927
Molecular weight (pH 7.5; Da) 302869.78 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
4.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9480500
pI 3.87
 
Comments
Comments catalyzes pseudouridation of U955, U2504, U2580 in 23S rRNA [PUB_0105, PUB_0119];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Huang L, Ku J, Pookanjanatavip M, Gu X, Wang D, Greene PJ, Santi DV. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA. Biochemistry 37, 15951-7 (1998). WholeCell: PUB_0119, PubMed: 9843401

  4. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:09