MG_208 – glycoprotease

Name
WID MG_208 View in model
Name glycoprotease View in model
Protein product MG_208_MONOMER
Cross references GenBank: AAC71426.1, BioCyc: MG_208, CMR: MG_208, SwissProt: P47450
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 245403250994 MG_206 MG_207 MG_208 MG_209 MG_210 MG_480 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 247903 (nt), Length: 591 (nt), Direction: Reverse, G/C content: 33.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGTTCTTTTTAAGTAAGTATAAGCTGTTTTTAGACTGTGCTTATAAAAC
CCTTAACATCATTATTTTAGAGATGAAAACCAATGCAGTGGTTGATGAGT
TGTCCATTGGTGTTGAACAGAACTTAACTGAACTTGCTGTTTATTATCTG
GAGACAATGTTAACAAAAAACAAGTTGAAAAAAAGCAGTATTAAACAGTT
TTATGTCACAATTGGCCCTGGTAGTTTCACCGGTCAGAGGATAGCAACTA
TCATTGCTAAAAGCTGGTGTTTATTGTATCCCAGTTGTGAACTTTATGCT
TTAAATTCACTCCGCTTTCAAATCCCATATGAACATGGGATTAGCAAGAT
TAGTTGTGGTAATGATCAGAACTATTGTGGACTATACAGCCAAACTACTA
GTGAAATAAAGCTAATTAGTAAAGCTGATTTTGTGAAGTTATGTAAGGCA
AACAATGAACTTCCTATGTATGAAAACTTTGAAAACATTGAGAGTTATAG
CAAGCTGTTATTAAGCAACATCGATCACTTTGAAAGAATCGAAGATCCTC
TAACCTTACAACCTATCTATCTAAAAGATCCTGTTAACTAA
50
100
150
200
250
300
350
400
450
500
550
591
View in model
Transcription unit TU_128 View in model
Empirical formula (pH 7.5) H6312C5720N2385O4125P591
Molecular weight (pH 7.5; Da) 192772.09 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6068300
pI 4.01
 
Comments
Comments Putative Zn-metalloendopeptidase; also called O-sialoglycoprotein endopeptidases; may be secreted [PUB_0015]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Huesgen PF. Functional genomics of Deg and GCP proteases in photosynthetic organisms. Universität Konstanz (2007). WholeCell: PUB_0015, URL: http://kops.ub.uni-konstanz.de/bitstream/handle/urn:nbn:de:bsz:352-opus-38884/Huesgen_Dissertation.pdf

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:19
Last updated 2012-10-01 15:13:09