MG_201 – co-chaperone GrpE

Name
WID MG_201 View in model
Name co-chaperone GrpE View in model
Symbol grpE
Protein product MG_201_MONOMER
Cross references GenBank: AAC71419.1, CMR: MG_201, BioCyc: MG_201, SwissProt: P47443
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 236664242318 MG_199 MG_200 MG_201 MG_202 MG_203 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 239164 (nt), Length: 654 (nt), Direction: Forward, G/C content: 35.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGTGTGAAAAATCACAAACAATTAAAGAGCTTTTAAACGCCATTAGAAC
CTTAGTTGTCAAGAACAATAAAGCTAAGGTTAGTATGATTGAAAAGGAAC
TGTTAGCTTTTGTTAGTGAACTTGACAAAAAGTTCAAACAACAACTCAAC
AACTTCAATGAACTACAACAAAAGATCCCACTACTCCAAAAAGCTAACGA
AGAGTTTGCTTTAAAGTTTGAAAGGATGCAACGCGAAGCACAAAACCAGA
TCCAAGCCAAACTAGATGAGTTGAATCTTAAAAATAAAAAGGAGTTAGAA
CAAGCCAAGAAATATGCGATTGCCAAAACCCTTGACCAACCCTTAAACAT
CATCGATCAGTTTGAAATCGCGCTTTCATATGCCCAAAAAGACCCTCAAG
TAAAAAACTATACCACTGGTTTTACCATGGTACTTGATGCTTTTTCAAGG
TGATTGGAAGCAAATGGGGTTACCAAGATTAAGATTGAACCAGGGATGGA
ATTTGATGAAAAGATTATGTCTGCATTGGAACTAGTTGATTCTAACCTTG
CTAAAAACAAGGTAGTAAGAGTCTCAAAATCTGGCTATAAACTCTATGAC
AAAGTGATCCGCTTTGCATCAGTATTTGTCAGCAAAGGTAATAAAAAATC
ATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
654
View in model
Transcription unit TU_122 View in model
Empirical formula (pH 7.5) H7030C6375N2775O4486P654
Molecular weight (pH 7.5; Da) 214552.52 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.1 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6745600
pI 3.60
 
Comments
Comments catalyzes release of peptide from peptide-DnaK-ADP complex [PUB_0014];
References
  1. Eds Lund P. Molecular Chaperones in the Cell. Oxford University Press, New York (2001). WholeCell: PUB_0014, ISBN: 9780199638673

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:08