MG_198 – ribosomal protein L20

Name
WID MG_198 View in model
Name ribosomal protein L20 View in model
Symbol rplT
Protein product MG_198_MONOMER
Cross references GenBank: AAC71416.1, CMR: MG_198, BioCyc: MG_198, SwissProt: P47440
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 233747239122 MG_195 MG_196 MG_198 MG_199 MG_200 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 236247 (nt), Length: 375 (nt), Direction: Forward, G/C content: 35.2%, Sequence:
1
51
101
151
201
251
301
351
ATGCGTGTTAAGGGAACAAATACAACCAGGATTAGAAGAAAAAAATGGTT
AAAACAAGCTAGTGGTAGCTTTGGGACAAGAAAAGCTTCTTTTAAGGCAG
CTAAACAAACTGTTATCCAAGCAAGCAAGTATGCTTACCGTGATAGGAGA
CAGAAAAAACGTGAGTTTCGTTCGTTGTGGATCTTAAGGTTAAATGCTGC
ACTGCGTGCACAAGGGATGACTTATTCAGTGTTTATCAATGAATTGAAAA
AAGCCAAGATAGTCATTAACAGAAAGGTACTTTCTGAACTAGCAATTAAA
GAACCTAATAAGTTAAATCTGATTATCAATACCATCAAAAAACCAACTAA
TAAACCAACTGTTGCAAAAACTTAG
50
100
150
200
250
300
350
375
View in model
Transcription unit TU_120 View in model
Empirical formula (pH 7.5) H4032C3656N1593O2571P375
Molecular weight (pH 7.5; Da) 123037.28 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
9.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3889500
pI 3.60
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:07