MG_190 – phosphoesterase

Name
WID MG_190 View in model
Name phosphoesterase View in model
Symbol mgpA
Synonyms recJ
Protein product MG_190_MONOMER
Cross references GenBank: AAC71409.1, BioCyc: MG_190, CMR: MG_190, SwissProt: P22746
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 218107224064 MG_187 MG_188 MG_189 MG_190 MG_191 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 220607 (nt), Length: 957 (nt), Direction: Forward, G/C content: 33.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGAAAAAAGGATCAATAACTGAAGCAATTAATGCCATTAAACAATTTGA
TAAGATTGTTATCTTTCACCATGTGCGCCCTGATGGGGATTGTTTAGGAG
CACAACAAGGCTTGTTTCACCTCATTAAAGCTAACTTTAAAAATAAGGAG
GTGAAGTGTGTTGGTAATAACAACAACCTGTTTAGCTTTATCAACATGAC
ATTTACCAACCAAATTGATGAGAGCTTTTTAAAAGAAGCACTTGCCATTG
TGGTCGATGCTAATTACAAAAACAGGATTGAATTGAGAGAACTGTTAGAT
AAAAACCTGTTTAAAGCAGTGTTAAGGATTGATCACCATCCCAATGAAGA
TGATCTAAACACTAGCTTTAACTTTGTTGAAGAAAGCTATGTAGCTTGTT
GTGAGCAGATAGTGGAGATGGCCACAGTGGCGAAGTGGACCATACCACCA
GTGGCTGCTACTTTACTATATATAGGTATCTATACGGATAGTAATAGATT
TCTATATAGTAATACATCATATAGAACACTATACTTAGCAGCAATACTAT
ATAAAGCTAAAGCTGATATAAGGATAGTACATGATCATTTAAACCATACT
AGTTTAGCAGATCTTAAGTTTAAAAAGTATGTTTATAACCACTTTAAAAC
CCAAGGACAAGTGATCTATTTTATCTGTACTAAAAAGATCCAAAAGAGAC
TAAGAATGACTGCAGATCAATGTGCTAGAGTTAACTTGTTAAGTAACATA
GCAGATTACAAGATCTGACTTTTCTTTATTGAACAAGCTAATAATGAGAT
CAGGATAGAACTGAGGAGTAATGGGATTAATGTCAGAGATATAGCCATTA
AGTATGGTGGGGGAGGACATAATAATGCAAGTGGAGCGATCATTACTAAC
AAAAAACAAATTAGTGATGTTGTTAGTGATTGTGTGAAAAAAATTGTTTA
TAATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
957
View in model
Transcription unit TU_117 View in model
Empirical formula (pH 7.5) H10247C9289N3942O6626P957
Molecular weight (pH 7.5; Da) 312763.71 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9997300
pI 3.83
 
Comments
Comments Introduction MG_190 codes for DHH phosphoesterase family protein with weak homology to 5-3' ssDNA exonuclease recJ [PUB_0110]. Carvalho et al concluded in 2005 that there is no recJ in M. genitalium [PUB_0072]. recJ Processive exonuclease, degrading ~1000 nt after a single binding event [PUB_0148]. DNA binding and nuclease activity of RecJ was specifically enhanced by the pre-addition of ssDNA-binding protein [PUB_0148]. Needs at least 7 ss nucleotides to bind [PUB_0148]. Exonuclease activity can be terminated by ds region [PUB_0148]. Releases mononucleotides [PUB_0148]. Possibly has exonuclease activity required to produce a free 3' single-stranded DNA to which RecA can bind for the initiation of homologous recombination [PUB_0147]. Exonuclease activity requires Mg2+, Mn2+, or Co2+ [PUB_0552]. Yamagata et al observed the exonuclease kinetics for the complete protein: kcat=2×10-3 1/s, Km=4.1 μM, and for a truncated protein: kcat>130 1/s, Km=6.1 μM [PUB_0552].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Carvalho FM, Fonseca MM, Batistuzzo De Medeiros S, Scortecci KC, Blaha CA, Agnez-Lima LF. DNA repair in reduced genome: the Mycoplasma model. Gene 360, 111-9 (2005). WholeCell: PUB_0072, PubMed: 16153783

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Han ES, Cooper DL, Persky NS, Sutera VA Jr, Whitaker RD, Montello ML, Lovett ST. RecJ exonuclease: substrates, products and interaction with SSB. Nucleic Acids Res 34, 1084-91 (2006). WholeCell: PUB_0148, PubMed: 16488881

  6. ... 3 more

  7. Iverson-Cabral SL, Astete SG, Cohen CR, Rocha EP, Totten PA. Intrastrain heterogeneity of the mgpB gene in Mycoplasma genitalium is extensive in vitro and in vivo and suggests that variation is generated via recombination with repetitive chromosomal sequences. Infect Immun 74, 3715-26 (2006). WholeCell: PUB_0147, PubMed: 16790744

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  9. Yamagata A, Masui R, Kakuta Y, Kuramitsu S, Fukuyama K. Overexpression, purification and characterization of RecJ protein from Thermus thermophilus HB8 and its core domain. Nucleic Acids Res 29, 4617-24 (2001). WholeCell: PUB_0552, PubMed: 11713311

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:06