MG_189 – Oligosaccharide or polyol ABC transporter, permease protein

Name
WID MG_189 View in model
Name Oligosaccharide or polyol ABC transporter, permease protein View in model
Protein product MG_189_MONOMER
Cross references GenBank: AAC71408.1, CMR: MG_189, BioCyc: MG_189, SwissProt: P47435
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 216982222939 MG_187 MG_188 MG_189 MG_190 MG_191 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 219482 (nt), Length: 957 (nt), Direction: Forward, G/C content: 36.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGTTCAAAAACAACTTACGCTTTACTAGTTGAATTAATCAACACAAGTT
TTACCAACTTGATCTGAGCTTAAAAACCCGCTCGATCAAACAAATTGTTT
TAACGTTGGTTTTCAAAACATTGGTATTGGGGTTTTTTGGGTTAATTGTC
ATCTTTCCCTTTTATCTGATGGTTGTGGTTAGTTTTGCTAGTGATGAAAG
AGCATTAGACACAAGAACCCCAATCCTTTGACCTGATAGTTGAAACTTTG
ATAACTTTAGTAGGGTGTTAAGTGATGGGAAATATCTCAATGCAATAGTT
GTCAATACTTTAGTAACGGTACTTTCAGTGTTACTAACATTGTTTTTTAC
CATTTGCATGGGTTATAGTTTTTCACTACGGAAGTGAAAATACAAAAAAC
TGGTGTGGTTTTTCTTTCTTAGTGTGTTAATACTGCCTGAGTCTGCGCTT
TTAATTGGTCAGTATCGGATTGTAATAGTTGCTAACTGAAATAACCCCAA
CAGTCCCTTGATTGTTCTGGGACTCATTATGCCCTTTGTTAGCAGTGTTT
TTAGTGGGTTTATGTACCGTACTAGCTTTGAAGCCATTCCATCTCAATTA
AAAGAGTCAGCACTCATTGATGGGTGTAATGGCTTTAACTACTTTTTGAA
GATTGCTTTACCAATGGTGAAATCTACCAGTTGAACAGTGGGGATTTTAA
CTGCATTTAGTGCTTGAAATTCCTATTTATGACCATTACTGTTGTTGGGC
AACAGGGTGGATTTAAACATTAACTTGTGGGTGTTACAACAAGGGATCTT
GGATGCTAACAGTAGTGATGAACAGATCAGAACGCTGTTAAATCTCAAGA
TGAGTGCAGCGATTCTAGCTATCCTTCCGATGTTTATTATCTACTTTTTG
TTCCATAAAAGGATTATGAATGCCATTAAAAACAGAGCCAACACCATTAA
GGGTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
957
View in model
Transcription unit TU_116 View in model
Empirical formula (pH 7.5) H10189C9231N3768O6767P957
Molecular weight (pH 7.5; Da) 311827.38 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
6.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9682300
pI 4.41
 
Comments
Comments sugar transport [PUB_0110, PUB_0439, PUB_0440]; sulfate/molybdate transport [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Ren Q, Chen K, Paulsen IT. TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids Res 35, D274-9 (2007). WholeCell: PUB_0440, PubMed: 17135193, URL: http://membranetransport.org/

  5. Saier MH Jr, Tran CV, Barabote RD. TCDB: the Transporter Classification Database for membrane transport protein analyses and information. Nucleic Acids Res 34, D181-6 (2006). WholeCell: PUB_0439, PubMed: 16381841, URL: http://www.tcdb.org/

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:06