MG_186 – Oligosaccharide or polyol ABC transporter, substrate binding protein

Name
WID MG_186 View in model
Name Oligosaccharide or polyol ABC transporter, substrate binding protein View in model
Protein product MG_186_MONOMER
Cross references GenBank: AAC71405.1, CMR: MG_186, BioCyc: MG_186, SwissProt: P47432
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 213516219269 MG_186 MG_187 MG_188 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 216016 (nt), Length: 753 (nt), Direction: Forward, G/C content: 36.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
ATGAAAGGGTTTTTAAAACCAAATTTCTCGCTCGGTGCTTTGTTTTTAAC
TTTAAGCCCCATAGCCACTGCATGCATTGCTGAAAAACCAGTTAACAACC
GCTTTAACTTTAATAGCGAGCAATTAGCTAGGCTAAGAAAAGCAAGGGTT
AACCACTGAAGAGATGGGGATACTTTGGAAGTTAGCTTTGCAAATAACCA
CCAAAAACCGATCCGTATCTATGCCATTGATACCCCTGAAAAAGCAGTTT
TATCTATACAACGCAAATCAGAGATAGAACTTAAAGAAGCTAATAAAGCA
ACTGAGTTTGCCAAAAGCTTAATTCCCATTGGTAGTGAGGTGTGGATCTG
ACCACTAAATAGCTATAGCTATGATCGTGAAGTAGCTGCAGTGTTTTTCA
AAACCAATCCATTGCAACTGCACTTTGAATCGTTTGCAGTTGAAATGGTA
GCAAATGGTCATGCTTTACCTATTGCTGGTAATGACTTTGATTTTGTTTT
TAGTGATTTGGACCCATTTAATCCCCTAAAAATAGTAGGGATTGAACTAG
CTAATGGTTTAAACAATGCTTTTAACAACAGAAAAAACATCTTTAGTTAT
TTAGAAAACAGTTTTCAATCAATAACAATGGTCTATCAACAACGCGGTGT
TGACCAAAGTTGAACAAGGTATTTAGCTCCTAGTAATGATTTTTCCTCTA
CTAAACTGGGGTTGGGATTAACCATCTATGAATTGAAACTAAACAATGGC
TAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
753
View in model
Transcription unit TU_115 View in model
Empirical formula (pH 7.5) H8058C7304N3087O5245P753
Molecular weight (pH 7.5; Da) 246326.62 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7657100
pI 3.90
 
Comments
Comments Staphococcal nuclease-like protein [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:06