MG_184 – adenine-specific DNA modification methylase

Name
WID MG_184 View in model
Name adenine-specific DNA modification methylase View in model
Symbol MunI
Protein product MG_184_MONOMER
Cross references GenBank: AAC71403.1, CMR: MG_184, BioCyc: MG_184, SwissProt: Q49400
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 207891213845 MG_182 MG_183 MG_184 MG_185 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 210391 (nt), Length: 954 (nt), Direction: Forward, G/C content: 30.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
GTGCACCATTTTAACCGCGCTAAAAAGGCCAAGAATAACGAGTTTTTTAC
TTTAATTGATGAGATTGAAAACGAAGTAATTAACTACCAAAAGCAGTTTG
CAAATAAAACCATTTTTTGTAACTGTAATGATGGTAAAAATTCCCATTTT
TTTCAGTTTTTTCAAACTAACTTTAACCAGTTACAACTAAAAAAACTCAT
TGGGTTTAGTTTTAATAATCTCTCACAAGCTGACAAGTTCACTTTTGATG
GAAATAAAGTAACTAAAACCAAATTAAAGGGTAATGGTGATTTTAGTTCT
GATGAATCGATTGAAGTGTTAAAACAAGCAGATATAGTTGTAACAAATCC
ACCCTTTAGTTTGTTTCAAAGTTTCATTGATCTGTTAATACAACACAACA
AGCAGTTTCTGGTTTTAGGGTTAAATGCAGCAGTTAGCTATAACCATATT
TTTACCTACTTTAAAACTAACAAGTTGTGGTTTGGCTATACCGTTAATAA
AACAATGAGTTTTTCAGTTAACAGTGACTATCAACTTTATAACCCCAAAA
CTAGTAACTTTTTTACAAAAAATGGCAAGTGTTTCCAAAAGATAGCAGGT
ATCTCTTGGTTTACTAATTTAGGAAAACCACATTATAACCCCTTTTTAAA
TACCAACTGTTTTTATAAAAACAACGAAAAAAACTATCCCAAGTTTGATT
GGTATGATGCTATTTATGTCAACAAGATTAAAAACATCCCTATGGATTGA
AATGGATTGATGGGAGTTCCTTTAACCTTTTTAAACTGTTACAACCCCAA
GCAGTTTGAATTAGTTGATTGTCTTGCTAACCCTTATGCTACCTTAGATA
CATTAAAAACAAATGCCTTTGTGAAATTAAATCAGGGTGATGTGAGAAAT
GTTAATGGTAAAAGAAGGTATGTAAGGGTAATAATTAAAAAACAACAAAT
TTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
954
View in model
Transcription unit TU_113 View in model
Empirical formula (pH 7.5) H10181C9226N3828O6643P954
Molecular weight (pH 7.5; Da) 310522.82 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9880700
pI 3.97
 
Comments
Comments MunI type II restriction/modification system methyltransferease [PUB_0098]. MunI type II restriction/modification system Recognizes the double-stranded sequence 5'-CAATTG-3' [PUB_0096], methylates the C-6 amino group of A-3 of hemimethylated DNA [PUB_0095, PUB_0096], and cleaves the C-A phosphodiester bond of unmethylated DNA [PUB_0544]. Methylation occurs by transfer from S-Adenosyl-L-methionine [PUB_0544]. Methylase transferase forms dimer. Restriction is ATP-independent and Mg2+-dependent [PUB_0544].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Das U, Daugherty L, Duquenne L, Finn RD, Gough J, Haft D, Hulo N, Kahn D, Kelly E, Laugraud A, Letunic I, Lonsdale D, Lopez R, Madera M, Maslen J, et al. InterPro: the integrative protein signature database. Nucleic Acids Res 37, D211-5 (2009). WholeCell: PUB_0095, PubMed: 18940856, URL: http://www.ebi.ac.uk/interpro/

  4. Martin B, García P, Castanié MP, Claverys JP. The recA gene of Streptococcus pneumoniae is part of a competence-induced operon and controls lysogenic induction. Mol Microbiol 15, 367-79 (1995). WholeCell: PUB_0098, PubMed: 7538190

  5. Pingoud A, Jeltsch A. Structure and function of type II restriction endonucleases. Nucleic Acids Res 29, 3705-27 (2001). WholeCell: PUB_0544, PubMed: 11557805

  6. ... 2 more

  7. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:05