MG_182 – tRNA pseudouridine synthase A

Name
WID MG_182 View in model
Name tRNA pseudouridine synthase A View in model
Symbol truA
Synonyms hisT
Protein product MG_182_MONOMER
Cross references GenBank: AAC71401.1, CMR: MG_182, BioCyc: MG_182, SwissProt: P47428
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 205343211078 MG_179 MG_180 MG_181 MG_182 MG_183 MG_184 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 207843 (nt), Length: 735 (nt), Direction: Forward, G/C content: 34.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
GTGGCTAGGTACTTGGGGATTGTTAGTTATGATGGCAGTTACTTTAAAGG
GTGAGCGATTCAACCAAACCTAGCTACTATCCAAGGTTTATTGGAGCAAA
GTTTTTCATTAATCATTGGCAGAAAGATAAAGGTAATTGGTTCAGGTAGA
ACTGATAAAGGGGTACATGCCATCAACCAAACCTTTCATGTTGATATTAA
TGGTGAAATTAATCTCAATTTGTTAATTAGAAAAATTAACCAGTTGATTA
AGCCCCACTGTATAGTTAAAACCTTGGTATTGGTTAACGATAGCTTTCAT
GCGCGGTTTCAAGTTAAAACCAAGGTGTATGAATATCTGATTAACTGTGG
GAATTTAAATCCGTTGCAATTTAACTATGTTTGGCAGTTAAACCAGCAAT
TGGATCTTGAAAAACTCAAAGCTGATGCCACTTTATTTTTAGGTAAGAAA
AACTTTCTTAGCTTCAGTAGTTCGATTCACACTGATTCAATTCGCACAAT
TAGTAAAATTACCATACAAAAAGAAACTAACCAACTAGTTAGACTAACTT
TTTTTGGCAGTGGTTTTCTCAGGAGTCAAGTGAGGATGATAGTTGCTTGT
TTAGTGAATTTAAACACTAATAAAATGGCACTTGAAACAGTTGCAAAATT
GTTTGAACACCCCAAGAAAGGGAGTTGTGTTGTTAAAGCCCCTAGTTGTG
GTTTGTATCTGAAAACAGTGGTATATGAAAAATAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
735
View in model
Transcription unit TU_112 View in model
Empirical formula (pH 7.5) H7851C7115N2970O5137P735
Molecular weight (pH 7.5; Da) 239923.71 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7568300
pI 4.06
 
Comments
Comments catalyzes pseudouridation of U38-40 in anticodon stem loop [PUB_0118]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Hur S, Stroud RM. How U38, 39, and 40 of many tRNAs become the targets for pseudouridylation by TruA. Mol Cell 26, 189-203 (2007). WholeCell: PUB_0118, PubMed: 17466622

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:05