MG_181 – metal ion (cobalt) ABC transporter, permease protein

Name
WID MG_181 View in model
Name metal ion (cobalt) ABC transporter, permease protein View in model
Symbol cbiQ
Protein product MG_181_MONOMER
Cross references GenBank: AAC71400.1, CMR: MG_181, BioCyc: MG_181, SwissProt: P47427
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 204088210351 MG_177 MG_178 MG_179 MG_180 MG_181 MG_182 MG_183 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 206588 (nt), Length: 1263 (nt), Direction: Forward, G/C content: 35.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
ATGGATAACTTTATTAATGGCTATATCCCAAGAAACAGCTTTGTTCACAA
GCTGCATCCAACTACTAAACTAGTAATCTTTTTACTGTTAGTTATCTTGG
TATTTGTACCAATTGGCTTTGTTTTTCAAAGTGTTATCTTTCTTTTTGTT
ACCTTTGTTTTTTTTATTGCTAAACTCCCGGGGCGGTTTTACAGTTCAGC
AATTAAGTCAATTACGCTGTTATTTCTCTTGTTGTTATTTGTAAACTGGT
TTACCTTTCGTGATCCAGGGTTTTATCTTACTAGTGATCAACTTAACAGT
TTACCAGCCATTGATAACAGCAAGTTTAGCTTTTGAAACATTAGTTTGTT
TAACTATCAAGATAATGTTTTTTCCCAGGTTTTTGCTTTTAACAGGGGTA
ATTTAACCAACTTAAATCAACTTGATTTTTTCTATAAAGCTAACAATGCT
GATAGTTACACCAAAGTAAAGGGCATTGATAGTTTAGCAAGTATGCTAGC
AAACAATGGCAATGGTTTAAGCAAAGACAAAATTCTGAGTGCTTTTTTAG
ATCACAATTTAAACCTTTATTTAGCGAGAAGTTGGGGGGCAAATTTTGCT
GGGTTTGTTGTTGATTTTAACCCAACAACCCAACTCTTTAAACTCACCCC
TTTTCTAGCAAATGCTAGTTATGTTTTAACGTTAAGAGCAGTTATCTTAG
CATTCTATGTCACCCAAAAGATCCTAATTATGATCTTATTTGCAACTGTA
CTCACTTCCACTTCAAGTTCAGTTGAACTAGCATATGGGATTGAAAGGTT
ATTATGACCTTTAAAACTCATTAAAATACCTGTTAATGTCTTTGCAATGA
CCATTGCCATTGCCATTAGGTTTGTCCCTTCCTTGTTACTAGAATCACAA
CGGATCTTAAATGCCCAAGCCTCCAGGGGTTTAGACTTTCGAAATGGGGG
ATTTTTAGTGAAGATGCGTTCACTCTCTTCGTTAGTAGTGCCAATGGTTT
CCATTGCCTTTCGCAATGCCTCTGAACTTGCTAGTGCAATGGAAGCAAGG
GGTTATCACCCTGCAAAGAAGCGCAGTAGTTATAGACAATACAAAATCAC
TTGGATTGATATTTTAGCGTTATTTTTGGTTTTTGCTTGGTTTGTTGTGA
TTATCTTTTTAACTATTAGAGGAGCGGTCTTTTTGGATCTAGGTACACCA
GAATGGTTATTAACAGGAAAGATTAATGAACAGGTAATCAGGGATCTGAA
GGTAAGTGGCTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1263
View in model
Transcription unit TU_111 View in model
Empirical formula (pH 7.5) H13432C12168N4929O8952P1263
Molecular weight (pH 7.5; Da) 411069.87 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
12732100
pI 4.49
 
Comments
Comments no predicted substrate binding protein in M. genitalium; cobalt/nickel transporter [PUB_0113, PUB_0440]; associated with the cobalamin (vitamin B12) biosynthetic pathways [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T, Yamanishi Y. KEGG for linking genomes to life and the environment. Nucleic Acids Res 36, D480-4 (2008). WholeCell: PUB_0113, PubMed: 18077471, URL: http://www.genome.jp/kegg/

  5. Ren Q, Chen K, Paulsen IT. TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids Res 35, D274-9 (2007). WholeCell: PUB_0440, PubMed: 17135193, URL: http://membranetransport.org/

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:18
Last updated 2012-10-01 15:13:05