MG_174 – ribosomal protein L36

Name
WID MG_174 View in model
Name ribosomal protein L36 View in model
Symbol rpmJ
Protein product MG_174_MONOMER
Cross references GenBank: AAC71393.1, CMR: MG_174, BioCyc: MG_174, SwissProt: P47420
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 200147205261 MG_170 MG_171 MG_172 MG_175 MG_176 MG_177 MG_178 MG_179 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 202647 (nt), Length: 114 (nt), Direction: Forward, G/C content: 37.7%, Sequence:
1
51
101
ATGAAGGTTAGAGCAAGCGTAAAACCAATTTGTAAAGATTGTAAGATCAT
CAAACGTCACCGCATCTTAAGGGTGATCTGCAAAACCAAAAAACACAAGC
AAAGGCAAGGATAA
50
100
114
View in model
Transcription unit TU_106 View in model
Empirical formula (pH 7.5) H1234C1119N507O770P114
Molecular weight (pH 7.5; Da) 37635.67 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
6.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
1169400
pI 3.29
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:04