MG_173 – translation initiation factor IF-1

Name
WID MG_173 View in model
Name translation initiation factor IF-1 View in model
Symbol infA
Protein product MG_173_MONOMER
Cross references GenBank: AAC71391.1, CMR: MG_173, BioCyc: MG_173, SwissProt: P47419
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 199924205137 MG_170 MG_171 MG_172 MG_175 MG_176 MG_177 MG_178 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 202424 (nt), Length: 213 (nt), Direction: Forward, G/C content: 37.1%, Sequence:
1
51
101
151
201
ATGAAAAACGATAAACTCTTTCTAACAGGTAAGATACTGGAAATTATCCA
TGGTGATAAGTACCGGGTGATGCTTGAAAACAATGTTGAGGTTGATGCAC
ATCTAGCAGGTAAAATGAAGATGAAAAGAACCAAGATTCTCCCTGGGGAT
GTTGTTGAGGTGGAATTTTCTCCCTATGATTTGAAACTAGGTAGGATAAC
CCAAAGAAAATAA
50
100
150
200
213
View in model
Transcription unit TU_105 View in model
Empirical formula (pH 7.5) H2288C2074N897O1470P213
Molecular weight (pH 7.5; Da) 69896.81 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2194500
pI 3.73
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:04