MG_172 – methionine aminopeptidase, type I

Name
WID MG_172 View in model
Name methionine aminopeptidase, type I View in model
Symbol map
Protein product MG_172_MONOMER
Cross references GenBank: AAC71390.1, CMR: MG_172, BioCyc: MG_172, SwissProt: P47418
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 199178204925 MG_169 MG_170 MG_171 MG_172 MG_175 MG_176 MG_177 MG_178 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 201678 (nt), Length: 747 (nt), Direction: Forward, G/C content: 35.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
ATGATCTATCTCAAATCTGCAAATGAAGTTGCAGGGATTAAAAAAGCATG
TGCAATCTTCAAAGCAGTTAAGGCATATTTTACAATTGAAAAGTTACTTG
GCAAAAAGTTGGTTACCATTGATCGTTTAATCAAACAATTCATTGAACAA
AAACAAGCTAAATGTGCGTTTCATGGTTATCTAGGTTTCCCTGGTTTTAA
CTGTCTATCGTTAAACCAAACGGTTATCCATGGAGTTGCCGATCAAACTG
TTTTTAAAGATAGTGATAAACTAACGCTTGACATTGGGATAGACTATCAT
GGTTATCTTTGTGATGCAGCTTTCACTTTACTTGGTAATAAAGCTGATCC
AAAGGCAGTAAAACTGTTAAATGATGTTGAACAAGCATTTAGTAAGGTAA
TTGAACCTGAGCTATTTGTTAACAATCCGATTGGTAATTTATCCAATGCG
ATCCAAACTTACTTTGAAAACAAGGGCTATTTTCTTGTCAAAGAGTTTGG
GGGTCATGGTTGTGGGATTAAGATCCATGAAGATCCTTTAATCTTAAACT
GGGGAGAGAAAAACCAGGGCGTTAGGTTACAAGAGGGGATGGTAATCTGT
ATTGAACCGATGGTTATGACTGATAGTAGTGAGATAACAATGGCAGCTAA
CAACTGGAATGTACTAACTTTAAAGAGTAAGTTTAACTGTCATGTGGAAC
AGATGTATCACATCACAAACAACGGCTTTGAATGTTTAACTAACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
747
View in model
Transcription unit TU_105 View in model
Empirical formula (pH 7.5) H7988C7240N3045O5209P747
Molecular weight (pH 7.5; Da) 244137.28 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
3.1 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7680000
pI 3.98
 
Comments
Comments cleaves peptide bond between N-terminal methionine and C,G,A,S,T,V, or P; dinuclear metalloenzyme [PUB_0023]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Mogk A, Schmidt R, Bukau B. The N-end rule pathway for regulated proteolysis: prokaryotic and eukaryotic strategies. Trends Cell Biol 17, 165-72 (2007). WholeCell: PUB_0023, PubMed: 17306546

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:03