MG_171 – adenylate kinase

Name
WID MG_171 View in model
Name adenylate kinase View in model
Symbol adk
Protein product MG_171_MONOMER
Cross references GenBank: AAC71389.1, CMR: MG_171, BioCyc: MG_171, SwissProt: P47417
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 198531204176 MG_168 MG_169 MG_170 MG_171 MG_172 MG_175 MG_176 MG_177 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 201031 (nt), Length: 645 (nt), Direction: Forward, G/C content: 34.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGTAGCACAGTTTAATAAGTTCATTATCTTAGGACCCCCAGGGGCAGG
AAAAGGTACAGTTTGTAAACTGCTTAGCAAAACAACTAAGTTAGTCCATA
TTGCTAGTGGTGATCTGTTTAGAGAAGCCATTAAAAACCAGAGTGTTATT
GGTAGAAAGATTGCAGCAATTATCAGTCAGGGTGGTTATGTTGATGATGC
CACTACTAACCAGCTTGTTTATGAATATATCACTACCAATCCATTACCAA
ATGGTTTTATCTTAGATGGTTATCCAAGAACAGAGAACCAGCTTGATTTT
CTAAATATTAAACTAACCATTGACATGGTCTTTGAACTAGTTGTTAGTGA
TCTGAATAAACTGATTACACGGATTGATAACAGGGTTATTTGTAACAACT
GTAACAGTGTTTATAACTTGCTTTTTCAAAAACCACTAGTTGAAAATAGT
TGTGATCAGTGTTCAGCTAAACTAGTGAAAAGGAGTGATGATAACAAAGC
AGTGGTCAAAGCAAGAATGGAGTTATATCAACAAACAATTCAACCAATCC
ACACTTACTTTTTCAACAAACAACTTTTAGTACAAATTGATTGCTTTTTA
CCACTAGAAGAACAACTCAAGACAATCAAACAATTTATTAGATAA
50
100
150
200
250
300
350
400
450
500
550
600
645
View in model
Transcription unit TU_105 View in model
Empirical formula (pH 7.5) H6901C6255N2640O4480P645
Molecular weight (pH 7.5; Da) 210715.55 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
3.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6657900
pI 3.87
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:03