MG_169 – ribosomal protein L15

Name
WID MG_169 View in model
Name ribosomal protein L15 View in model
Symbol rplO
Protein product MG_169_MONOMER
Cross references GenBank: AAC71387.1, BioCyc: MG_169, CMR: MG_169, SwissProt: P47415
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 196658202111 MG_163 MG_165 MG_166 MG_167 MG_168 MG_169 MG_170 MG_171 MG_172 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 199158 (nt), Length: 453 (nt), Direction: Forward, G/C content: 37.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGGAACTACACCAATTAAAAAGTGTCTCTAAAAGCCGTAACCACAAGTC
CAAAGTGGTAGGTAGGGGCCATGGCTCGGGATTAGGTAAAACATCATCAC
GTGGTCAAAAGGGACAAAAAGCAAGAAAATCAGGTTTAACTAGGTTAGGT
TTTGAAGGGGGACAAACACCCCTTTACCGCCGGTTGCCTAAGTATGGGGT
TGCTAACAAAGGGATCTTAAAAAAAAGGTGGGTTGTTTTAAATTTGAACA
AAGTTGCTAAACTCAATCTCAAAACAGTTACTAGAGCAACTTTGATTGAA
AAAAAGGTAATTAGTAAAAAAAATAACCTCCCTTTGAAGTTAATTGGGAA
CACAAAACTCACTACTCCCATCCACTTTGAAGTGCAAAAAATCTCCAAAA
ATGCTTTAAATGCAGTGCAAACTAGCAAAGGTAGTGTGAAAATTATCACC
TAA
50
100
150
200
250
300
350
400
450
453
View in model
Transcription unit TU_104 View in model
Empirical formula (pH 7.5) H4876C4422N1941O3106P453
Molecular weight (pH 7.5; Da) 148938.11 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
6.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4653300
pI 3.57
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:03