MG_163 – ribosomal protein L5

Name
WID MG_163 View in model
Name ribosomal protein L5 View in model
Symbol rplE
Protein product MG_163_MONOMER
Cross references GenBank: AAC71381.1, CMR: MG_163, BioCyc: MG_163, SwissProt: P47409
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 193953199496 MG_157 MG_158 MG_159 MG_161 MG_162 MG_163 MG_165 MG_166 MG_167 MG_168 MG_169 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 196453 (nt), Length: 543 (nt), Direction: Forward, G/C content: 36.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGAATAACCTTGAAAAAACCTATAAAACTGAGTTAGTTAATCAACTCCA
ACAACAGTTGGGCTTTTCTTCCATTATGCAAGTCCCTAAGTTAACAAAAA
TCGTTGTTAACATGGGAGTTGGGGATGCAATTAGAGACAACAAGTTCCTT
GAATCAGCACTAAATGAACTGCACCTGATTACTGGTCAAAAACCCGTTGC
TACTAAAGCTAAGAATGCTATCTCAACTTACAAGTTACGTGCTGGCCAAT
TAATTGGTTGTAAAGTTACTCTAAGAAATAAAAAGATGTGATCCTTTCTG
GAAAAATTAATCTATATTGCTCTGCCCAGAGTAAGGGACTTTCGCGGTTT
ATCACTGCGCTCTTTTGATGGGAAAGGTAACTATACGATTGGCATTAAAG
AACAGATTATCTTCCCTGAAATTGTCTATGATGATATCAAAAGAATTAGG
GGTTTTGACATCACTATTGTCACTTCCACCAACAAAGATAGTGAAGCACT
TGCTTTACTGAGAGCACTAAAGATGCCGTTTGTAAAAGAATAG
50
100
150
200
250
300
350
400
450
500
543
View in model
Transcription unit TU_102 View in model
Empirical formula (pH 7.5) H5815C5271N2238O3776P543
Molecular weight (pH 7.5; Da) 177748.84 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
3.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5523600
pI 3.87
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:02