MG_162 – ribosomal protein L24

Name
WID MG_162 View in model
Name ribosomal protein L24 View in model
Symbol rplX
Protein product MG_162_MONOMER
Cross references GenBank: AAC71380.1, CMR: MG_162, BioCyc: MG_162, SwissProt: P47408
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 193621198948 MG_157 MG_158 MG_159 MG_161 MG_162 MG_163 MG_165 MG_166 MG_167 MG_168 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 196121 (nt), Length: 327 (nt), Direction: Forward, G/C content: 35.5%, Sequence:
1
51
101
151
201
251
301
ATGCAAAGGATTAGAAAAGGTGATAAGGTAGTTGTGATCACTGGTAAAAA
CAAGGGTGGTAGTGGGATAGTGCTTAAGGTATTAACCAAGCAAAACAAAG
CGATTGTTGAGGGGATCAATAAGGTTACTGTTCACAAAAAAGAACAAGTC
AACAAGCGCAGCAAACAAACAAACCCAACTACTAAAGAAGCCCCTTTACC
ATTAAATAAACTTGCTTTATTTGATCAGAAGGCCAAACAGCAAACAATTG
GCAAGATCAAATACCAAATTGATCCTAAAACCAAACAAAAAACAAGAGTC
TTTAAGAAGACTAATAATGCCATTTAA
50
100
150
200
250
300
327
View in model
Transcription unit TU_102 View in model
Empirical formula (pH 7.5) H3529C3201N1428O2217P327
Molecular weight (pH 7.5; Da) 107603.80 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3406000
pI 3.40
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:02