MG_160 – ribosomal protein S17

Name
WID MG_160 View in model
Name ribosomal protein S17 View in model
Symbol rpsQ
Protein product MG_160_MONOMER
Cross references GenBank: AAC71378.1, BioCyc: MG_160, CMR: MG_160, SwissProt: P47406
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 192992198250 MG_156 MG_157 MG_158 MG_159 MG_161 MG_162 MG_163 MG_165 MG_166 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 195492 (nt), Length: 258 (nt), Direction: Forward, G/C content: 37.2%, Sequence:
1
51
101
151
201
251
ATGAAGCGCAACCAACGTAAGCAGTTAATTGGCACAGTTGTTAGCACCAA
AAATGCTAAAACAGCAACTGTCAAAGTAACATCACGCTTTAAACATCCTT
TGTATCACAAATCAGTTATTCGCCATAAAAAGTACCATGTCCATAACTTT
GGTGAACTTGTTGCTAATGATGGTGATAGGGTACAAATTATTGAAACAAG
ACCCCTTTCCGCTTTAAAGCGGTGAAGGATTGTCAAAATCATTGAAAGAG
CAAAATAG
50
100
150
200
250
258
View in model
Transcription unit TU_102 View in model
Empirical formula (pH 7.5) H2772C2513N1089O1779P258
Molecular weight (pH 7.5; Da) 84684.26 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2623200
pI 3.66
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:01