MG_158 – ribosomal protein L16

Name
WID MG_158 View in model
Name ribosomal protein L16 View in model
Symbol rplP
Protein product MG_158_MONOMER
Cross references GenBank: AAC71376.1, CMR: MG_158, BioCyc: MG_158, SwissProt: P47404
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 191974197391 MG_154 MG_156 MG_157 MG_158 MG_159 MG_161 MG_162 MG_163 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 194474 (nt), Length: 417 (nt), Direction: Forward, G/C content: 41.0%, Sequence:
1
51
101
151
201
251
301
351
401
ATGTTACAACCAAAAAGAACCAAATACAGAAAACCACATAACGTCAGTTA
TGAAGGACACACTAAGGGCAATGGTTATGTTGCTTTTGGTGAGTATGGAA
TTGTTGCTACTAAGGGTAATTGGATCGATGCGAGAGCAATTGAATCAGCG
CGGGTTGCTATCTCAAAGTGCTTGGGTAAAACTGGAAAGATGTGAATCAG
GATCTTCCCCCACATGTCAAAAACCAAAAAACCCTTAGAAGTGAGGATGG
GTTCAGGGAAAGGTAACCCTGAATTTTGGGTTGCTGTTGTTAAAAAGGGG
ACAGTGATGTTTGAAGTTGCTAACATCCCTGAACAACAGATGATCAAAGC
CTTAACAAGAGCAGGCCATAAACTCCCTGTTACCTGAAAACTAATGAAAA
GAGAGGAGAACAGTTAA
50
100
150
200
250
300
350
400
417
View in model
Transcription unit TU_102 View in model
Empirical formula (pH 7.5) H4490C4072N1791O2870P417
Molecular weight (pH 7.5; Da) 137353.39 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4268000
pI 3.62
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:17
Last updated 2012-10-01 15:13:01