MG_155 – ribosomal protein S19

Name
WID MG_155 View in model
Name ribosomal protein S19 View in model
Symbol rpsS
Protein product MG_155_MONOMER
Cross references GenBank: AAC71373.1, CMR: MG_155, BioCyc: MG_155, SwissProt: P47401
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 190459195723 MG_151 MG_152 MG_153 MG_154 MG_156 MG_157 MG_158 MG_159 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 192959 (nt), Length: 264 (nt), Direction: Forward, G/C content: 36.4%, Sequence:
1
51
101
151
201
251
ATGTCAAGAAGTAGTAAAAAGGGCGCATTTGTTGATGCTCACCTCTTAAA
AAAAGTGATTGAAATGAACAAACAAGCCAAGAAAAAACCAATTAAGACTT
GGTCAAGAAGAAGTACTATCTTCCCTGAGTTTGTGGGTAACACCTTCAGT
GTGCATAACGGTAAAACCTTTATTAATGTTTATGTTACTGATGATATGGT
AGGTCATAAGTTGGGTGAGTTTTCCCCAACTAGAAACTTTAAACAACACA
CTGCTAACCGTTAG
50
100
150
200
250
264
View in model
Transcription unit TU_102 View in model
Empirical formula (pH 7.5) H2831C2566N1098O1829P264
Molecular weight (pH 7.5; Da) 86492.16 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
7.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2699200
pI 3.79
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:13:01