MG_154 – ribosomal protein L2

Name
WID MG_154 View in model
Name ribosomal protein L2 View in model
Symbol rplB
Protein product MG_154_MONOMER
Cross references GenBank: AAC71372.1, CMR: MG_154, BioCyc: MG_154, SwissProt: P47400
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 189602195460 MG_150 MG_151 MG_152 MG_153 MG_154 MG_156 MG_157 MG_158 MG_159 MG_478 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 192102 (nt), Length: 858 (nt), Direction: Forward, G/C content: 40.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGGCAATTAAAAAGATTATTAGTCGTTCTAACAGTGGGATTCACAACGC
CACTGTCATTGACTTTAAAAAACTCCTTACCAATTCCAAACCCGAAAAGT
CGCTTTTAGTTACTTTAAAAAAACATGCAGGAAGAAACAACCAGGGCAAG
ATCACTGTTCGCCACCACGGTGGGAGACATAAACGTAAGTACCGTTTAAT
TGATTTTAAGCGTTACCACTATGACAATTTAAAAGCAACTGTTAAATCGA
TTGAATATGATCCTAACCGCAGTTGTTTTATCTCCCTTTTACACTATCAG
AATGGGGTTAAAACTTACATCATTAGTCCTGATGGGATTAAGGTTGGTGA
TCAAGTTTATTCATCTGATCATGCCATTGATATCAAACTAGGTTATTGTA
TGCCCCTTGCTTTTATCCCTGAAGGAACCCAAGTTCATAACATTGAACTT
AACCCTAAGGGTGGGGGTAAGATAGCAAGAAGTGCTGGAAGTTATGCGAG
GATCTTGGGTCAAGATGAGACTGGTAAATACATCATTCTCCAGTTAATCT
CAGGGGAAACTAGGAAGTTTTTAAAGGAGTGTAGAGCTACAGTTGGTGTT
GTCTCTAACTTAGATCATAACCTTGTTGTAATTGGTAAAGCAGGGAGAAG
TCGTCATAAGGGAATCAGACCAACGGTTAGAGGTTCAGCAATGAACCCTA
ATGACCACCCGCATGGGGGTGGGGAAGGGAGAAGCCCAGTTGGCAGAGAT
GCACCAAGAACCCCTTGGGGCAAACGCCATATGGGTGTGAAAACACGTAA
CATGAAAAAACATTCAACTAACCTGATTATTAGAAACAGAAAAGGAGAAC
AATACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
858
View in model
Transcription unit TU_102 View in model
Empirical formula (pH 7.5) H9214C8355N3615O5945P858
Molecular weight (pH 7.5; Da) 281962.36 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
7.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8760400
pI 3.75
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:13:00