MG_153 – ribosomal protein L23

Name
WID MG_153 View in model
Name ribosomal protein L23 View in model
Symbol rplW
Protein product MG_153_MONOMER
Cross references GenBank: AAC71371.1, CMR: MG_153, BioCyc: MG_153, SwissProt: P47399
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 189282194603 MG_150 MG_151 MG_152 MG_153 MG_154 MG_156 MG_157 MG_478 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 191782 (nt), Length: 321 (nt), Direction: Forward, G/C content: 34.6%, Sequence:
1
51
101
151
201
251
301
ATGGATGTAACCAACATACTCTTAAAACCAGTCTTAACTGAAAAGAGTTA
TCTCAACCAGATGGGGGAATTGAAAAAATATGTCTTTGCAATTAACCCTA
AAGCTACTAAAACCAAAGTAAAACTAGCGTTTGAAATTATCTATGGGGTT
AAACCTTTAAAGATTAACACGCTAATTAGAAAACCAGTGACCATTAGAAA
TGGCACTAAATACCCTGGGTTTAGTAAGCTAGCAAAACTAGCAGTAATCA
CCTTACCTAAGGGAATGGATATTGCCATTACTGGTGAGAAAACAACCAAG
AAAGAAACAAAGGATCAATAA
50
100
150
200
250
300
321
View in model
Transcription unit TU_101 View in model
Empirical formula (pH 7.5) H3455C3133N1374O2192P321
Molecular weight (pH 7.5; Da) 105370.30 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
6.6 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3323200
pI 3.52
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:13:00