MG_150 – ribosomal protein S10

Name
WID MG_150 View in model
Name ribosomal protein S10 View in model
Symbol rpsJ
Protein product MG_150_MONOMER
Cross references GenBank: AAC71368.1, CMR: MG_150, BioCyc: MG_150, SwissProt: P47396
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 187546192867 MG_148 MG_149 MG_150 MG_151 MG_152 MG_153 MG_154 MG_478 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 190046 (nt), Length: 321 (nt), Direction: Forward, G/C content: 36.4%, Sequence:
1
51
101
151
201
251
301
ATGAATAGCGCTGTAAAATATCCTGAGCTGAAGATCAAACTTGAGTCTTA
TGATAGCACCCTTTTAGATCTCACTATTAAAAAGATAGTTGAGGTTGTAA
AGGGTGTGAACATTAAGATTAAAGGTCCTTTACCTTTGCCTACTAAAAAG
GAAGTGATCACCATTATCCGCTCTCCCCATGTTGATAAAGCATCCAGAGA
GCAGTTTGAAAAAAATACCCACAAGCGCTTAATGATTCTTGTTGATGTTA
ATCAAGGAGGGATTGATAGTTTAAAAAAGATTAAGATCCCAGTTGGGGTT
ACACTGCGTTTTTCAAAATAG
50
100
150
200
250
300
321
View in model
Transcription unit TU_099 View in model
Empirical formula (pH 7.5) H3437C3115N1320O2234P321
Molecular weight (pH 7.5; Da) 105051.58 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
5.1 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3283300
pI 3.89
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:13:00