MG_149 – lipoprotein, putative

Name
WID MG_149 View in model
Name lipoprotein, putative View in model
Protein product MG_149_MONOMER
Cross references GenBank: AAC71367.1, CMR: MG_149, BioCyc: MG_149, SwissProt: P47395
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 186107191953 MG_147 MG_148 MG_149 MG_150 MG_151 MG_152 MG_478 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 188607 (nt), Length: 846 (nt), Direction: Forward, G/C content: 33.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGAAATTATACCGATCTTTAAAAGCAGCCCTGTTACCAGGGATATGCAC
TAGCATTTTACTTGCTAGTTGTGCTTCAACAAATACTTATCAAGACCAAA
GGAATGCCTTGATTAGTTTGGCTTCTAATCGTGATACTTTAATTGCGAAT
GCTAAAAAATCCAAAGAAGAAGTGCAAAAAGAAGTTACCAAAATGAATAG
TAGTACTTCATCAATGATGACAGCTACCCAAAGTGTTGCAATTACAACAC
ATCAAACTACTGAAAAAACAAATAATTCTAAGTATGATCTAGACAAGCTT
TTTAAGGATTACATCCTTTATGTTGTTGATAATTTTTCAGGACTTGTTTT
TAAAAGAACTGGCGGTCATAGGATCCAGTTAATCGATAAGGATAAAGAGA
TTTTGGATGGTGGTAATCTAACTAAACATACCCACCACGATCATAACCAT
ATGCATAATCATGAACATGAACATGAAGAACACCATGATGAGGAAGAGAC
AGAAGTAGTTGGCAGAGCACTATCTTTTACTAATGGCATCTTTCTAGTGA
TTGACTATAAAAAAGACTCTGAAAGAAAAAATATGAGTGGTTCAACTACT
ATGATGCACCAACACCACCATGAAGCTGAAGAACATAAAGAGGAACGTAA
GCTCTCTTTAAACTTAAAAGCATACAAATTTAATACCCCTTTTAACATTA
GTGAGTTTATTAGTGCTTGACATCATAAAGAATCTCATAATAGTGACACA
GAGTTCAATAACCTTCACAATAAGTATGACAAGGAAGAATTGGATATTAT
TGACTATAACTTTGAAGAAAAAGCTGTTGATGAAACAATTGCTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
846
View in model
Transcription unit TU_097 View in model
Empirical formula (pH 7.5) H9068C8221N3513O5837P846
Molecular weight (pH 7.5; Da) 276677.47 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8777600
pI 3.73
 
Comments
Comments activates NF-{kappa}B via TLR1/2 [PUB_0194];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. McGowin CL, Ma L, Martin DH, Pyles RB. Mycoplasma genitalium-encoded MG309 activates NF-kappaB via Toll-like receptors 2 and 6 to elicit proinflammatory cytokine secretion from human genital epithelial cells. Infect Immun 77, 1175-81 (2009). WholeCell: PUB_0194, PubMed: 19103762

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:13:00