MG_143 – ribosome-binding factor A

Name
WID MG_143 View in model
Name ribosome-binding factor A View in model
Symbol rbfA
Protein product MG_143_MONOMER
Cross references GenBank: AAC71361.1, BioCyc: MG_143, CMR: MG_143, SwissProt: P47389
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 180351185690 MG_141 MG_142 MG_143 MG_144 MG_145 MG_146 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 182851 (nt), Length: 339 (nt), Direction: Forward, G/C content: 32.4%, Sequence:
1
51
101
151
201
251
301
ATGGCAAGCTATAGAAAACAACGGATTGAAAATGATATCATCCGCTTAAT
TAATCGCACGATTATTAATGAGATCTATGATCCTGTTGTTAAGTTAGGTC
ATGTTAGCCATGTGAAGTTATCAGCTGATTTTTTTCATGCAGTAGTTTAT
CTTGATTGTTATGATCGTAGTCAGATTCAAACTGTAGTTAATGCTTTTAA
AAAGGCTCAGGGCGTTTTTAGTCAAATGTTAGCACAAAATTTGTACCTAG
CTAAAAGTGTAAAACTCCACTTTGTGAAGGATGATGCAATTGACAATGCT
TTGAAAATAGAACAGATAATTAACTCTTTGAAAAACTAA
50
100
150
200
250
300
339
View in model
Transcription unit TU_092 View in model
Empirical formula (pH 7.5) H3616C3276N1353O2373P339
Molecular weight (pH 7.5; Da) 110409.38 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
3.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3486100
pI 4.12
 
Comments
Comments binds 30S ribosome subunits near binding site for A- and P-site tRNAs [PUB_0104]; overlapping function with era [PUB_0104]; processes 16S RNA precursor [PUB_0105];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:12:59