MG_141 – transcription termination factor NusA

Name
WID MG_141 View in model
Name transcription termination factor NusA View in model
Symbol nusA
Protein product MG_141_MONOMER
Cross references GenBank: AAC71359.1, CMR: MG_141, BioCyc: MG_141, SwissProt: P47387
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 176651183247 MG_140 MG_141 MG_142 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 179151 (nt), Length: 1596 (nt), Direction: Forward, G/C content: 32.5%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
ATGAAGATAACTTTCATTTCTGGACAAGAAGTGTCGTTAGGCACTTCTTT
TTTATTGTTTTCAAAAAAAATAGTTATGAATGAATTAAACCAACCCTTAC
TTGCTATTATTAAAAATGTTGCTAAAACCAAAAACCTTTCTATAGAAGAG
GTGGTTTTTTGTTTGAAAACAGCTTTAGAACAAGCCTATAAAAAACACCT
TAACTTTGTTAATGTTGAAGTTAACATTAACTTTGATAAGGGGATTATTA
ATGTTGAACAACTCTTTAATGTTGTTAGTGATGAAAATGAAGATTATGAT
GACTTTCTTGAAATCCCTTTACAAGCAGCTAACAAAATAAACAGTTCATT
GCAATTAGGTGATGTGTTGCGAAAACCAATCCCCTTAAAAAACATTAGTA
GTGATCTTATCAATAAGATGATTGCTATCTTTAACCAAAAGATTAGTGAA
ACAAACTTTAAAGCAGTAATGAGTGAGTTTAGTAGTGAGGTTGGGGAAGT
GATTGAAGCGAAAGTTGAAGATATTGATACTAACAAAGAAGGTGGTTTAA
AGGGTTATATTATTAACCTTGAAACTACAAAGGGTTATATCTCCAAGCGG
GAATTGTCAAAAGGGGAGCGCTTAGAGATAGGTAAAAAATACCTCTTTGT
TATCAAAGAAATCCAACGGCAAGCATCGTTATGACCAATTACTTTATCAA
GAAGTGATACCCGCTTACTACAGTTTTTGTTAACTTCAAATACTCCAGAA
ATTGAAAATGGTACGATTGTAATCAAAAAGATTGAACGTTCCCCAGGAGT
GAAATCAAAGATAGCAGTTATCTCCAATGATCCTGCAGTTGACCCAGTTG
CTGCTATCTTAGGACCTAAGGGTGAGAAGATTAGGGGGATTAGTGAGGAA
TTTAATGGTGAGATTATTGACATTGTCTTTTGGAATGAAGACAAGTTAAA
GTTCTTAATTAATGCCATTTTACCTGCAGAAGTCATTGGTTATAACATCT
TGCAGGATGATGAGCGTGATACTAGTATTGAAGTTGTTGTACCTGCAAAC
CAAATTGCTAATGTTTTTGGTTTTAAAGGTGTAAACATTAGGTTAATTAG
TAATTTAACAGGTTGAAATAGTGTTGATGTTTACAGTGAAAAAGATGCAA
GTGAAGCCAACATTAAATTCACGAGGTTAAGCTTTGAACCTGAAGGGTTG
TTTGGCATCAAAAAAAGAAGGGAAAAGATCATTAGTAATGATGCTACTGA
TAAAGTCTTTTACACCTCTAAAGACAATGTGATAGATGATGAGATTATTG
TTGATTTAGCTAAAGATCTAATGGTTGATAATAAACAAAAACAACCTGAG
CAAGTTGCAAAGCAAGTTGTTGAAAAATCACAATTAGAAAAACAAGTTAC
TCCAAAAGAAAAAGAGAAAGTTCAACCAAAAGCTAAGGTTCATTCTAATA
GCCATTCCAAAAAACCAGCTAAACCTAATCAGATTTTTTCTATCACTGTT
GATGCTAGTGATAAGAATCTTAAAAAAGATCAAGTTGATAATAACCAAAC
AAACCCCCAAACAAAACAAACATTTGATAGCTTTGATGATCTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1596
View in model
Transcription unit TU_090 View in model
Empirical formula (pH 7.5) H17074C15477N6531O11062P1596
Molecular weight (pH 7.5; Da) 520995.79 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
3.6 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
16648700
pI 3.87
 
Comments
Comments transcription antitermination has not been reported in any mycoplasma [PUB_0182]; rho not essential in B. subtilis [PUB_0234]; the five sequenced members of the pneumoniae clade all contain most of the necessary machinery for forming an [PUB_0182]; binds RNA polymerase and promotes termination at certain RNA hairpin structures [PUB_0110]; binds Rho and RNA polymerase [PUB_0233]; helps bind Rho to elongation complex [PUB_0233]; slows RNA polymerase by enhancing pausing [PUB_0233];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Ciampi MS. Rho-dependent terminators and transcription termination. Microbiology 152, 2515-28 (2006). WholeCell: PUB_0233, PubMed: 16946247

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  6. ... 2 more

  7. Washio T, Sasayama J, Tomita M. Analysis of complete genomes suggests that many prokaryotes do not rely on hairpin formation in transcription termination. Nucleic Acids Res 26, 5456-63 (1998). WholeCell: PUB_0234, PubMed: 9826772

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:12:59