MG_139 – ribonuclease J

Name
WID MG_139 View in model
Name ribonuclease J View in model
Symbol rnjA
Synonyms ykqC
Protein product MG_139_MONOMER
Cross references GenBank: AAC71357.1, CMR: MG_139, BioCyc: MG_139, SwissProt: P47385
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 162971169681 MG_137 MG_138 MG_139 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 165471 (nt), Length: 1710 (nt), Direction: Forward, G/C content: 34.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
ATGATAAAGGATTTTAATCCTGGTGATTTTATTGGTAAAAAACCAACTAA
AATCTATGCTTTTGGTGGTATCCAAGAAGTTGGTAAAAACATGTATGGGA
TTGAATATGATGATGAAATCATCATTATTGACTGTGGCATTAAATTTGCT
AGTGATGATCTACTTGGCATCAATGGGATTATCCCTAGTTTTGAACACTT
AATTGAAAACCAAAGTAAGGTTAAAGCATTGTTTATTACCCATGGTCATG
AAGACCATATTGGGGGTGTACCATACCTTTTAAAGCAGGTTGATATTCCT
GTTATCTACGCACCAAGGATCGCAGCATCATTAATCTTGAAAAAGGTTAA
TGAGCACAAGGATGCTAAGCTCAATAAGATAGTTACTTTTGATGATTTTA
GTGAGTTTCAAACCAAACACTTCAAAATTGATTTTTACCGGGTAAACCAC
TCGATTCCCGATGCTTTTGGAATCTGTGTGCAAACCCCTAATGGCAACAT
TGTTCAAAGCGGTGACTACCGGTTTGATTTTGCTGCTGGGAGTGAGATGT
TAGATGTTCATAAAGTAGTGAAAATTGCCGAGCGCAATGTCCATGTTTTT
ATGAGTGAATCTACTAATGCTGAAGTACCAGGTTTTTCCCAAAGTGAAAA
GTTAATTTACAGAAACATCCAAAAGATCTTAAAAGAAGCAAGGGGTAGGG
TTATTTTAACTACTTTTGCATCTAACATCACACGGATTAATGAAATTATT
GAGATTGCTTTAAACAACAAACGCAAGATCTGTTTATTGGGTAAATCAAT
GGATGTTAATGTTAATATTTCACGCAAAATTGGATTGATGGCAATTGATA
GTAATGATATTGTGGAAGTTCGTGATATCAAAAACTATCCTGATCGTAAT
ATCTTAATCTTGTGCACTGGTTCACAAGGTGAGGAGGCTGCTGCTTTAAA
CACAATGGCACGTGGTAAGCATAATTGGGTGAGCTTAAAATCAACTGACA
CCATTATTATGTCTTCAAATCCAATTCCAGGTAATTATGCTGCAGTTGAA
AACTTGCTTAATGAACTCTCTAAGTTTGGTGTTGCTATTTATGAAAATTC
ATCCCAACTAAAACTACATGCCTCAGGTCATGCCACTCAACAAGAGTTAC
AGTTGATGCTAAATTTAATGTTTCCTAAATACTTAATTCCTATCCATGGT
GAATTTAAGATGATGCGAACCATAAAAAACATTGCTAATGAATGTGGCAT
TAAAAGCGAGGATGTGGCGCTTTTAAGTAATGGCCAAGTAATGTATTTAA
TTGATGAAGAACTTTATTATTCCAATGAAATTATTAATGCTGATCCTATT
TATATAGAGAGTCATAACTCTTCTCCTGATCTTGCAAGAATAATTAAGCA
AAGACAAATCCTTAGTCGTGATGGGATGTTTGCTGTTATTGTTGTTTTTG
ATAAGAATAATAACATCATTGGGATTCCAACCTTAATAACAAGGGGTTGT
TTCTTTGCACTTGATTCCAATCCTTTAATGACAAAGATAGCCCATTCTGT
TAAAAGAACTTTAGAAAGTGTTATCCAAAGTAAGAAGTTTAATAGTCATG
AACAACTAACAAAGGAATTGAAACGAGTTTGTAAGGAAACTGTTTCTTAC
TTTATCTGAAAAAATAAAAACCGTAATCCCTTAATTTCAACTGTGCTTTC
CTGGATCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1710
View in model
Transcription unit TU_087 View in model
Empirical formula (pH 7.5) H18255C16544N6882O11958P1710
Molecular weight (pH 7.5; Da) 557784.37 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
17563200
pI 4.06
 
Comments
Comments beta-CASP family [PUB_0163]; mRNA degradation ribonucleases J1/J2 [PUB_0110]; endoribonucleolytic activity similar to RNase E and 5'-to-3' exoribonucleolytic activity [PUB_0041, PUB_0165]; Cleaves the 5'-leader sequence of certain mRNAs [PUB_0096]; 5' maturation of 16S, 23S rRNA [PUB_0166]. Kinetic rate in B. subtilis 0.37 1/s [PUB_0692].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Callebaut I, Moshous D, Mornon JP, de Villartay JP. Metallo-beta-lactamase fold within nucleic acids processing enzymes: the beta-CASP family. Nucleic Acids Res 30, 3592-601 (2002). WholeCell: PUB_0163, PubMed: 12177301

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Madhugiri R, Evguenieva-Hackenberg E. RNase J is involved in the 5'-end maturation of 16S rRNA and 23S rRNA in Sinorhizobium meliloti. FEBS Lett 583, 2339-42 (2009). WholeCell: PUB_0166, PubMed: 19540834

  6. ... 5 more

  7. Niranjanakumari S, Day-Storms JJ, Ahmed M, Hsieh J, Zahler NH, Venters RA, Fierke CA. Probing the architecture of the B. subtilis RNase P holoenzyme active site by cross-linking and affinity cleavage. RNA 13, 521-35 (2007). WholeCell: PUB_0692, PubMed: 17299131

  8. Portnoy V, Schuster G. Mycoplasma gallisepticum as the first analyzed bacterium in which RNA is not polyadenylated. FEMS Microbiol Lett 283, 97-103 (2008). WholeCell: PUB_0041, PubMed: 18399989

  9. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  10. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  11. de la Sierra-Gallay IL, Zig L, Jamalli A, Putzer H. Structural insights into the dual activity of RNase J. Nat Struct Mol Biol 15, 206-12 (2008). WholeCell: PUB_0165, PubMed: 18204464

 
Metadata
Created 2012-10-01 15:07:16
Last updated 2012-10-01 15:12:58