MG_134

Name
WID MG_134 View in model
Protein product MG_134_MONOMER
Cross references GenBank: AAC71351.1, CMR: MG_134, BioCyc: MG_134, SwissProt: P47380
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 157298162601 MG_130 MG_131 MG_132 MG_133 MG_134 MG_135 MG_136 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 159798 (nt), Length: 303 (nt), Direction: Forward, G/C content: 32.7%, Sequence:
1
51
101
151
201
251
301
ATGAGTTTTAAAAAGATTGCTGAAATGATGCGTCAAGCAGAACGAGAAAC
TAAGAAAAAAACATTAGCGTTTGAACAACAAGCCTTTGAATACAACTATA
AAAATGGTGCGATTAAGATCACTATTTTAGGTGATCTTACACTTAAATCA
ATTAACATCGATCCTGTTTTGATTGATGCAAGTGACAAAGTTATTCTAGA
GGAGATGATTATAGAAGCTACTAATGAAGCGGTTAGTGATGTGAAAACCA
AGTATGATAACTTAGTTGAGAAAACTATGCCAAAAGTTCCAGGTCTTTTC
TAA
50
100
150
200
250
300
303
View in model
Transcription unit TU_084 View in model
Empirical formula (pH 7.5) H3247C2943N1254O2092P303
Molecular weight (pH 7.5; Da) 99040.35 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3153100
pI 3.78
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:57