MG_132 – purine nucleoside phosphoramidase

Name
WID MG_132 View in model
Name purine nucleoside phosphoramidase View in model
Symbol hinT
Protein product MG_132_MONOMER
Cross references GenBank: AAC71349.1, CMR: MG_132, BioCyc: MG_132, SwissProt: P47378
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 156081161507 MG_129 MG_130 MG_131 MG_132 MG_133 MG_134 MG_135 MG_136 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 158581 (nt), Length: 426 (nt), Direction: Reverse, G/C content: 31.9%, Sequence:
1
51
101
151
201
251
301
351
401
ATGGAAAAAAACACCACAAGTAGTTGTATCTTTTGTGATATTGTTCAAGG
TTCAATTACATCCTATAAAATTGGAGAAAATGAGCATGCCATTGCTTTTT
TAGATGCTTTTCCTGTAGCTGATGGTCATACTTTAGTAATCCCTAAAAAA
CATGCAGTTGATTTTTCTTCAACTGATCAAAAAGAGTTACAAGCAGTTAG
TTTATTAGCAAAACAAATCGCTTTAAAACTAAAGATGACACTAAAACCAT
CTGGTTTAAACTATGTTTCTAATGAAGGGGCAATTGCAGGTCAAGTGGTT
TTTCATTTTCACTTACACATAGTACCCAAATATGAAACTGGTAAAGGGTT
TGGCTATAATGTCAATAAAACCAACAAACGTTCCTTAGAAGAAAACTACC
AACTAATATCTGAAAGCAAAAATTAA
50
100
150
200
250
300
350
400
426
View in model
Transcription unit TU_082 View in model
Empirical formula (pH 7.5) H4555C4128N1734O2957P426
Molecular weight (pH 7.5; Da) 138963.84 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4380500
pI 3.87
 
Comments
Comments HINT (histidine triad nucleotide-binding protein) subgroup: Members of this CD belong to the superfamily of histidine triad hydrolases that act on alpha-phosphate of ribonucleotides [PUB_0110]; cleanse spontaneously adenylylated proteins (aminoacyl-AMP and acyl-AMP), a consequence of life at high temperature with high levels of ATP [PUB_0114]; involved in cell-cycle regulation in eukarya [PUB_0113]; may be cellular scavengers of inadvertently released aminoacyl-adenylates [PUB_0116]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Brenner C. Hint, Fhit, and GalT: function, structure, evolution, and mechanism of three branches of the histidine triad superfamily of nucleotide hydrolases and transferases. Biochemistry 41, 9003-14 (2002). WholeCell: PUB_0114, PubMed: 12119013

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Chou TF, Wagner CR. Lysyl-tRNA synthetase-generated lysyl-adenylate is a substrate for histidine triad nucleotide binding proteins. J Biol Chem 282, 4719-27 (2007). WholeCell: PUB_0116, PubMed: 17158446

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 2 more

  7. Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T, Yamanishi Y. KEGG for linking genomes to life and the environment. Nucleic Acids Res 36, D480-4 (2008). WholeCell: PUB_0113, PubMed: 18077471, URL: http://www.genome.jp/kegg/

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:57