MG_131 – hypothetical protein

Name
WID MG_131 View in model
Name hypothetical protein View in model
Protein product MG_131_MONOMER
Cross references GenBank: AAC71356.1, CMR: MG_131, BioCyc: MG_131
 
Classification
Type mRNA View in model
 
Structure
Structure 155523160810 MG_128 MG_129 MG_130 MG_131 MG_132 MG_133 MG_134 MG_135 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 158023 (nt), Length: 287 (nt), Direction: Forward, G/C content: 26.5%, Sequence:
1
51
101
151
201
251
ATGCAATACAGTGCTTTAATACCACTTTTTATATTACTAATTAGCTTAGT
ATTATTTTGTTTCAGCTTTAGAAAAAATCAAAGTGAAAATCAGATAGTGA
AAATCTTATTTTTTGCTTATTGCATCGATTTTTTAGCTTTAATTCTTGCT
GTAATGTTGCTCACTTTTTTAAGTCATGGGTTGTTAAGTTTAGCGATTTT
AATCCCTGTCTTAGTTTTTCAATAATAATGTTTTTTGTTATGGTTATTAG
TCACTATCCCCTTATGAAAAGACTATTTGGAAATTAA
50
100
150
200
250
287
View in model
Transcription unit TU_081 View in model
Empirical formula (pH 7.5) H3030C2742N1051O2055P287
Molecular weight (pH 7.5; Da) 92476.57 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.0 (dimensionless) (Show evidence)
View in model
Half life
0.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2919400
pI 8.28
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:57