MG_128 – inorganic polyphosphate/ATP-NAD kinase, probable

Name
WID MG_128 View in model
Name inorganic polyphosphate/ATP-NAD kinase, probable View in model
Symbol nadK
Protein product MG_128_MONOMER
Cross references GenBank: AAC71346.1, BioCyc: MG_128, CMR: MG_128, SwissProt: P47374
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 152944158724 MG_125 MG_126 MG_127 MG_128 MG_129 MG_130 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 155444 (nt), Length: 780 (nt), Direction: Forward, G/C content: 33.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
ATGAAATACAAAATTTTTGCTTCCACAACGCCCCAAACTGAACCTGTTCT
CAATAAGTTAAGAGCAGTTTTAAAAACTTGGCAAGCGGTTGAGAATGGTT
ATGAATATGTGTTTGTTTTAGGTGGGGATGGTTTTTTTGTTTCCACACTT
GCTAACTATAACTGTGATAGTTGTAAGGTAGTTGGTATCAATACTGGCCA
CATTGGTTTTTACACTTCTTTTAATGGAGATGATCTTGATGAAAATTTCA
TTTCAAAACTAACTAGCTTTGAGTTTAAAAAGATTAATTTACTGGAAGTG
AAAACTAAAAACCACAGTTTCTTAGTTTTAAATGAACTTGCAGTTTACAC
CAACACTGCATATCCAATTAACATCTTTATTGATGATAACCACTGGGAAT
CATACCGCGGTTCAGGGTTGCTAATTGGCCCAAGAACAGGTTCAACTGCC
CTAGCAAAATCTGCTAAGGGAGCGGTTATCTTTCCAAATGTTGATGTTGT
TCAAATTATTGAACTAAACCCCTTATTACATCCCAACCAAATCACAATTC
AATCTCCGATTATTCTGCCAATGCAAACCAAGGTTGAATTTAGGATCAAA
AAAGCTTTTAAAGCAGAGCAATTTCCCAATTTTTATGCAGATGGAATCAA
GCTTGATTTAAAAAATGAAGATACCAGTATTAGCTTTCAGTTGGTTTTAT
CAAGATCAATGTTTCACGCTTCTTTAAAAACTAAGGATTTTATTGATAAA
CTAAAATCAACTTTTATTAAGCAAAGCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
780
View in model
Transcription unit TU_078 View in model
Empirical formula (pH 7.5) H8323C7542N3126O5459P780
Molecular weight (pH 7.5; Da) 254258.68 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7944300
pI 4.06
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:57