MG_127 – Spx subfamily protein

Name
WID MG_127 View in model
Name Spx subfamily protein View in model
Symbol spx
Synonyms yjbD
Protein product MG_127_MONOMER
Cross references GenBank: AAC71345.1, BioCyc: MG_127, CMR: MG_127, SwissProt: P47373
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 152499157937 MG_124 MG_125 MG_126 MG_127 MG_128 MG_129 MG_130 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 154999 (nt), Length: 438 (nt), Direction: Forward, G/C content: 31.5%, Sequence:
1
51
101
151
201
251
301
351
401
ATGAAAAAAGCGGGTAAAAAAAATAGTGATGCAGGTAAGACTTTTATCTT
AATCTCATCATCCTGTTCATCCTGTCAGAAAGCCATTGAGTTTTTTGATC
AAAACAAAATTAGCTATGTTGTTGAGAATTTTTATAAAAAACCAATTAGT
GATAAGCGTTTTAAAGATATTTTAAGTCTTAGTGAGGATGGTACTGAAAG
TTTGTTTTCCAAACGTGCTGATCAGATTAAAGCAACTAACAGTGTTAGTG
TTGAAGAGTTGAGTATCAGTGAATTAATTAAGCTAGTTAGAGAACGTCCT
TCTTTACTAAGAAGGCCTATTATCATCCAATATAATTCTTCAGGAATTCC
TAAAAGGATGCGAATTGGTTATAACTCATCTGAAATTAAGGTCTTTGAGC
GTAAACTAATAGAACCAAAGCCTATAATACAACAATAA
50
100
150
200
250
300
350
400
438
View in model
Transcription unit TU_078 View in model
Empirical formula (pH 7.5) H4679C4240N1770O3047P438
Molecular weight (pH 7.5; Da) 142749.89 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4554200
pI 3.95
 
Comments
Comments major function is to restore thiol balance under disulfide stress through transcriptional regulation [PUB_0112]; upregulatex trxA, trxB [PUB_0112]; Interferes with activator-stimulated transcription by interaction with the RNA polymerase alpha-CTD. May function to globally reduce transcription of genes involved in growth- and development-promoting processes and to increase transcription of genes involved in thiol homeostasis, during periods of extreme stress [PUB_0096]; inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP, disrupting complex formation between RNAP and certain transcriptional activator proteins like ResD and ComA. In response to oxidative stress, Spx can also activate transcription, making it a general regulator that exerts both positive and negative control over transcription initiation [PUB_0110]; regulated by clpP protease [PUB_0111];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Nakano S, Zheng G, Nakano MM, Zuber P. Multiple pathways of Spx (YjbD) proteolysis in Bacillus subtilis. J Bacteriol 184, 3664-70 (2002). WholeCell: PUB_0111, PubMed: 12057962

  5. Newberry KJ, Nakano S, Zuber P, Brennan RG. Crystal structure of the Bacillus subtilis anti-alpha, global transcriptional regulator, Spx, in complex with the alpha C-terminal domain of RNA polymerase. Proc Natl Acad Sci U S A 102, 15839-44 (2005). WholeCell: PUB_0112, PubMed: 16249335

  6. ... 2 more

  7. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:57