MG_125 – Cof-like hydrolase, putative

Name
WID MG_125 View in model
Name Cof-like hydrolase, putative View in model
Protein product MG_125_MONOMER
Cross references GenBank: AAC71343.1, BioCyc: MG_125, CMR: MG_125, SwissProt: P47371
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 150582156440 MG_122 MG_123 MG_125 MG_126 MG_127 MG_128 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 153082 (nt), Length: 858 (nt), Direction: Forward, G/C content: 29.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGATTGATCTGCTTGGTTTGGATCTGGATGGAACGTTATTATCTAAAAC
TAAAAAAATTAACAATCCATCAAAATTAGCATTAACTAATTTAATTGCTA
AAAAACCAAGTTTAAAGGTGATGATTTTAACTGGTAGATCAGTTTTTTCT
ACTCTAAAACACGTTGAAAAGCTGAACAGTTTGTTTAAAAAACCAATTGT
TGATTATTTTTGTTGTTATGGGGGTGCTAAACTTTATCAAATTGAAGCAA
ATAAGCCACAAGAAAGATACAAGTTTTGCTTGGAAAACAGTGTTGTTGAA
ACTACCTTTAGTATTATCAAAAAACACCGCGGATTATGTTTAGCTTACTT
AGATAGTTATGTCTCTCCTTACCTTTGTTTAGCTGGTAACAAGCTCCTTG
GGTGGTTCACTAAATACTTTTGGTATAGAAAAAGGTGTGTGTTTTTTAAC
CAGAACCATTTAAAACAAGGTATTCTAAAGATTAGTGTTTACTTTTTAAG
TGCAAAAAGGTGTAAAAAAGTTTATGAAATCTTAAAAAATACCTTTCAAG
AAAAGGTTAATGTTTTAAGTTTTTCTAATAATTTAATTGAGATAACTCAT
CATGATGCTAATAAGGGTTATGCAATTGAATATATGGCCAAAAGAGAACA
ACTTTCACTTAATAGAATAGCAGTTATTGGTGATTCTTGAAATGATTATG
CAATGTTCAAAAAAGCTAAATATTCCTTTGCAATGTCAAAATCCCCTTCC
CAGTTAAAATTAATTGCTACCAATACCAGTAACAAAACCAACCGTTACCG
CTTTAGTACCTTACTTAATTTAATTAGTGAAACAATCATTAATCAAAAAG
CTGATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
858
View in model
Transcription unit TU_076 View in model
Empirical formula (pH 7.5) H9146C8287N3411O5989P858
Molecular weight (pH 7.5; Da) 278923.70 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8894100
pI 4.06
 
Comments
Comments HAD-like hydrolase superfamily [PUB_0096]; most HAD proteins have phosphatase activity, e.g. g1p --> glc + pi [PUB_0108]; several HAD catalyze dehalogenase (C-halogen bond hydrolysis), phosphonatase (C-P bond hydrolysis), and ß-phosphoglucomutase (CO-P bond hydrolysis and intramolecular phosphoryl transfer) reactions [PUB_0108]; several additional functions have been annotated for HAD proteins -- lipopolysaccharide biosynthesis, degradation of 2-phosphoglycolate produced during DNA repair, biosynthesis of serine, detoxification, glycation repair to free proteins from the glycation products derived from direct nonenzymatic glycosylation [PUB_0108]; HAD phosphatases have broad and overlapping substrate spectra [PUB_0108]; none of the HAD proteins are essential in E. coli [PUB_0108];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Kuznetsova E, Proudfoot M, Gonzalez CF, Brown G, Omelchenko MV, Borozan I, Carmel L, Wolf YI, Mori H, Savchenko AV, Arrowsmith CH, Koonin EV, Edwards AM, Yakunin AF. Genome-wide analysis of substrate specificities of the Escherichia coli haloacid dehalogenase-like phosphatase family. J Biol Chem 281, 36149-61 (2006). WholeCell: PUB_0108, PubMed: 16990279

  4. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:56