MG_124 – thioredoxin

Name
WID MG_124 View in model
Name thioredoxin View in model
Symbol trx
Protein product MG_124_MONOMER
Cross references GenBank: AAC71342.1, CMR: MG_124, BioCyc: MG_124, SwissProt: P47370
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 150268155577 MG_122 MG_123 MG_124 MG_125 MG_126 MG_127 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 152768 (nt), Length: 309 (nt), Direction: Forward, G/C content: 33.3%, Sequence:
1
51
101
151
201
251
301
ATGGTAACAGAAATTAGAAGTCTTAAACAACTTGAAGAGATCTTTTCAGC
TAAGAAAAATGTTATTGTTGACTTTTGAGCAGCATGATGTGGTCCTTGTA
AACTAACCAGCCCTGAGTTTCAAAAAGCAGCAGATGAATTTAGTGATGCT
CAGTTTGTTAAGGTTAATGTTGATGATCATACTGATATAGCAGCAGCTTA
TAACATTACCTCTTTACCAACTATTGTTGTTTTTGAAAACGGGGTTGAAA
AAAAGAGAGCCATTGGCTTTATGCCAAAAACCAAAATTATTGATCTTTTC
AATAACTAA
50
100
150
200
250
300
309
View in model
Transcription unit TU_076 View in model
Empirical formula (pH 7.5) H3301C2991N1248O2156P309
Molecular weight (pH 7.5; Da) 100797.05 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
2.8 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3162600
pI 4.01
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:56