MG_121 – Monosaccharide (riboside/galactoside) ABC transporter, permease protein

Name
WID MG_121 View in model
Name Monosaccharide (riboside/galactoside) ABC transporter, permease protein View in model
Symbol rbsC
Protein product MG_121_MONOMER
Cross references GenBank: AAC71339.1, CMR: MG_121, BioCyc: MG_121, SwissProt: P47367
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 145739151660 MG_119 MG_120 MG_121 MG_122 MG_123 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 148239 (nt), Length: 921 (nt), Direction: Forward, G/C content: 35.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
ATGTTAAGTTTAGCACAATTAGAAAGTTGGTTTTTTATCGCTCCAGCACT
GCTTTTAGCAGTATTGAGTGGTTATCTCGCTGAACGCGTTGGGATCATTA
ATATTGCTATTAATGGTGGAATGGTGTTTGGTGGGTTATTTATGGCACTC
TTATCGTATGGATTTACAAATAACTTAAATCAATCCGCTCCCTCCTGATC
ACTATTTATCACCATTCCCTTATCAGTTTTATTTAGTAGTGTTATAGGTT
GTTTATTTGCACTAGCAGCAGTTAAGTTAAGAGCAGATCATGTTATTGTG
GGAACTGGGATTAACTTGTTGGCTAGCGGAATTACCCTTTTTATTAGTCA
GAATGCTGCTAGTTTGTTTTCCGATACTACCTTAAGAGTAAGGTACTTAT
TTCCCATCCAAACTACTGTTAGTATAGAAGCAATTGGTGTGTTTGTTTTT
AGTTTACTTCTGATTGGGTTTGTATGGTACTTGATGAGTTTTACTAAAAC
TGGGTTGAGATACCGTGCGGTAGGTGAGAATCCTAATGTAATTGATACCC
AAGGGATTAGTGTTTACAAATACCAATGGATAGGCGCAATTTGTTCAATG
ATGGTAGCTGGATTGAGTGGTAGTTTGTTTGTTTTAAGTGTTTCTAACTT
TCCCTTTAACAGCGGAGATGTAAATGGCTTGGGTTTTATTGCTATTGCCA
TTATGATTATCTCAATGTGAAGAATTATCCCTAGCATCTTTATTGGGTTA
ATCTTTGCATATGCCTATGTTTTTACCAATAGTCAAATAGGATCTAATAG
TAATTCCTACTTGTTAAGAACGATCCCTTTCATCATCTCATTACTAGTAA
TGTTGTTATTTGGTTTTCTTAATGTTGCCCCAAAAAATATAGGTAAACAT
TTTGACAAGGGTTTAAGATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
921
View in model
Transcription unit TU_074 View in model
Empirical formula (pH 7.5) H9777C8855N3540O6561P921
Molecular weight (pH 7.5; Da) 299291.64 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9346900
pI 5.06
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:56