MG_117

Name
WID MG_117 View in model
Protein product MG_117_MONOMER
Cross references GenBank: AAC71335.1, CMR: MG_117, BioCyc: MG_117, SwissProt: P47363
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 140811146456 MG_113 MG_114 MG_115 MG_116 MG_117 MG_118 MG_119 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 143311 (nt), Length: 645 (nt), Direction: Forward, G/C content: 30.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGATAAAAATATTTTTCAATTAGTACAAAGTTTTGCTAAAACGCAAAA
TGTGCGAGCTAATTACACCTCACAAGACAAAAATATTAGTTTAGATTTTG
TTAGTTTTGAAACAGTTAGTCAATCACTAACAGGTTTTCTAATTTTTAAT
AATTTCAATAAATTGTTACAACTAATTGAACTGATAAAACAAAAGCAAAC
ATGATTATATGTAGATCAGCTCTGAATTGTTGATCTTTCCAATAACAAAG
CCTTAACTGATGCTACTGTTTGGATTATTAAACAAGAAAAATTGCCTGTT
TCAGTTGCGGCTTTTAGCAACCAACAACTCAACCAAGTTTATCGCAATTC
ATCCACAAGTCCTTTGTATCTTAGTTATGTCAAACCAATCGAAGTTCAAC
AATTTTTTACACTTTCTCCATCCATTAACAATAATCCTTTTTTAAATCAA
AATCCTTTAACTGAATCACCATTTGATAACAATAATCAGCTGTTTCAAGC
AACAAAGAGCGTTGAACCTTCAATGGAAACAATGGAATTTTCCCGGTTTA
TGGATGAATTTGATCAGATTACAAAGAACTTTTCTGATATAGAGCTTGAA
CCTATGCAATTCACCCAAAGTTTTGATGATTGGAGCAAAGACTAG
50
100
150
200
250
300
350
400
450
500
550
600
645
View in model
Transcription unit TU_073 View in model
Empirical formula (pH 7.5) H6883C6237N2586O4496P645
Molecular weight (pH 7.5; Da) 209980.84 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6610600
pI 3.95
 
Comments
Comments similarity to the superoxide dismutase (Mn/Fe family), C-terminal domain [PUB_0182];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:55