MG_115 – competence/damage-inducible protein CinA domain protein

Name
WID MG_115 View in model
Name competence/damage-inducible protein CinA domain protein View in model
Symbol cinA
Protein product MG_115_MONOMER
Cross references GenBank: AAC71333.1, CMR: MG_115, BioCyc: MG_115, SwissProt: P47361
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 139581145055 MG_112 MG_113 MG_114 MG_115 MG_116 MG_117 MG_118 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 142081 (nt), Length: 474 (nt), Direction: Forward, G/C content: 34.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
TTGTTTGCCAATTTAATAGCAGAAAAACTCCAAAAGTTACAACTTAGTGT
TGCAACAGCTGAATCAGTTACTGGTGGCTTATTAGCTCATTGTTTAACTT
CCATTGATGGTGCTTCTAACTATTTTAATGGCGGTGTTATTGCTTACAAT
AACCAAGTTAAGATTAACTTACTGAATGTTCAATCCTCCACAATTGCAAA
CCATGGGGCAGTTTCCAGTTTCTGTGCTAGGGAGATGGCAGTTGGGGTTA
AACAAAAGTTTCAAGCTGATGTGGGTATTGCTTGCAGTGGGATAGCAGGT
AGTAAAGCAGTTGAAAATAAAGCAATAGGATTACTTTTTTTCTGTATTAT
TATAGGAAATAAGGCTTATGATTTTGAGTTTGAAATGAACCAAAATAATC
GTAAGGATAACATTGAATTATTTACCAATAAGATCTTGGAATCTTTCCAC
TATTTGTTAACAAAGCTAGCTTAA
50
100
150
200
250
300
350
400
450
474
View in model
Transcription unit TU_072 View in model
Empirical formula (pH 7.5) H5055C4580N1890O3328P474
Molecular weight (pH 7.5; Da) 154504.19 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
1.0064 (dimensionless) (Show evidence)
View in model
Half life
5.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4848600
pI 4.20
 
Comments
Comments In S. pneumoniae cinA is the first gene in the cinA-recA-dinF operon [PUB_0524]. There are conflicting reports on the involvement on cinA in recombination: Peterson et al report that cinA is significantly expressed during competence induction, but is not required for transformation [PUB_0525]; Martin et al report that cinA is not expressed during competence induction [PUB_0098]. CinA may function as a recombination accessory protein [PUB_0099]; CinA may be specifically required at some stage in the process of transformation [PUB_0098].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Blanchard A, Browning G. Mycoplasmas: molecular biology, pathogenicity and strategies for control. CRC Press (2005). WholeCell: PUB_0525, ISBN: 9780849398612

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Martin B, García P, Castanié MP, Claverys JP. The recA gene of Streptococcus pneumoniae is part of a competence-induced operon and controls lysogenic induction. Mol Microbiol 15, 367-79 (1995). WholeCell: PUB_0098, PubMed: 7538190

  5. Mortier-Barrière I, de Saizieu A, Claverys JP, Martin B. Competence-specific induction of recA is required for full recombination proficiency during transformation in Streptococcus pneumoniae. Mol Microbiol 27, 159-70 (1998). WholeCell: PUB_0524, PubMed: 9466264

  6. ... 2 more

  7. Narumi I, Satoh K, Kikuchi M, Funayama T, Kitayama S, Yanagisawa T, Watanabe H, Yamamoto K. Molecular analysis of the Deinococcus radiodurans recA locus and identification of a mutation site in a DNA repair-deficient mutant, rec30. Mutat Res 435, 233-43 (1999). WholeCell: PUB_0099, PubMed: 10606814

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:55