MG_114 – CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase

Name
WID MG_114 View in model
Name CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase View in model
Symbol pgsA
Protein product MG_114_MONOMER
Cross references GenBank: AAC71332.1, BioCyc: MG_114, CMR: MG_114, SwissProt: P47360
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 138846144557 MG_111 MG_112 MG_113 MG_114 MG_115 MG_116 MG_117 MG_118 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 141346 (nt), Length: 711 (nt), Direction: Forward, G/C content: 31.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
GTGGATTGGAAAACATCAGAGATGCTATTCCCTTTCCCCGTGTACATGGC
ACCATTAACTTCTAAATTCGCTGCTTATAAAAAAAAGATTGCAAACTGGT
TAACAGTTTACAGAATTTTTATTGCTTTACCTACTATTATTTTTATTGCT
TTAGATAATCAACTAGGAGTTTTAGCTAACTTTTCTGTTGGTGCAATTAG
CATTAGTTTACAGATCAGTTTATTGATTGGAGGATTTTTGTTTTTAACTG
CAGTTATATCAGATTATTTAGATGGATATTTAGCAAGAAAATGGCTAGCA
GTTTCTAACTTTGGTAAATTATGAGACCCCATTGCTGATAAAGTGATTAT
CAATGGTGTTCTTATTGCACTAGCGATTAATGGATATTTTCACTTTAGCT
TATTAATTGTTTTTATAGTCCGTGATCTTGTGTTGGATGGAATGCGGATT
TATGCTTATGAGAAAAAGGTGGTTATTGCTGCTAACTGACTTGGAAAATG
AAAAACTATCATGCAGATGGTTGGTATTGTTTTTAGTTGTTTTGTTTGGA
GTTTTAAACAAAGTGAAATAGCTTCTTTGAATAGTGGACTGTTCTTTTGA
TTACTAACTCAACTGCCATATTATTTAGCAGCAGTTTTTTCAATTTGGTC
TTTCATTGTTTATAACATCCAAATATATCAGCAACTAAAGGCTTATAACT
CCAAGTTATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
711
View in model
Transcription unit TU_071 View in model
Empirical formula (pH 7.5) H7543C6831N2718O5050P711
Molecular weight (pH 7.5; Da) 230537.23 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7262200
pI 4.89
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:15
Last updated 2012-10-01 15:12:55