MG_110 – ribosome small subunit-dependent GTPase A

Name
WID MG_110 View in model
Name ribosome small subunit-dependent GTPase A View in model
Symbol rsgA
Synonyms yjeQ
Protein product MG_110_MONOMER
Cross references GenBank: AAC71328.1, CMR: MG_110, BioCyc: MG_110, SwissProt: P47356
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 134755140592 MG_107 MG_108 MG_109 MG_110 MG_111 MG_112 MG_113 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 137255 (nt), Length: 837 (nt), Direction: Forward, G/C content: 29.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGCCAGATTCTAACTTTGGGATAGTGCTTCAGTCATTAGCAAAACAATG
CAAAGTATTTTGGAATAACCAGATAATAACTGCTTTTCCTCAAAAGAAGT
TACAGTGAAAAAATGATTTTAAGTTGATGGTTGGTGATAGGGTTCAACTT
GAAGATGGTGCGATCACTAAAGTTTTAGCTAGAAAAAATGAACTTACAAG
ACCAAGGGTTGCTAATGTTGATCAGATTGTTTTAATCCAATCACTAGTTC
AACCTAAGATTAACTGAATTCAACTGTTGAAATTATTGGTATATTTCAAT
GCTAAATTAATTGATGAAATACCTATTTTAATAACAAAAACAGACCTTGA
TTTTGATCCAATGGAAAAACAAAAGTTAATCGATTTAAAACAGTTTAACT
ATCAGTTATTTTTTGTTTCTAAAAATGAACCACTACCTTCAGAATTAATC
GATATTTTTAGTAAAAAACTAAGTGTTTTTACAGGTCAATCTGGTGTTGG
TAAATCTAGCTTAATTAATCGTTTAGATCCTTCTTTAAAACAAAAGATTC
AAGCCTTATCAGTTAATAAATTTGGTAAGAATACCACTACTAAAACAACA
CTTTTTTCATTTAGAGGCGGTTTTATTTGTGACACCCCTGGTTTTAATGT
AATTTCTATTAAAAACCTCAAAATTTTAGCAGCCCAACACTTTGTTGGTT
TTCAGAAAATGATTAGTAAGTGTCATTTTTCTAACTGTTATCATCAGTAT
GAAAAAGATTGCTTTGTAACCACAAGTGTTATGAAAAACAGATATCCTTC
GTGATTGTATGAGAAGTATAGAAAAATGATTAATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
837
View in model
Transcription unit TU_068 View in model
Empirical formula (pH 7.5) H8919C8081N3318O5846P837
Molecular weight (pH 7.5; Da) 271979.72 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
2.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8692200
pI 4.08
 
Comments
Comments 3' maturation 16S rRNA [PUB_0101]; may play role in joining 30S and 50S subunits [PUB_0104]; depletion results in slow growth, accumulation 17S RNA [PUB_0101]; promotes dissociation of tRNA from ribosome [PUB_0102]; GTP hydrolysis promotes dissociation with ribosome [PUB_0102]; interacts with ribosome near A- and P-sites of 30S ribosome [PUB_0104]. Kinetic rate in H. sapiens 0.0005 1/s [PUB_0689].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Bourne HR, Sanders DA, McCormick F. The GTPase superfamily: conserved structure and molecular mechanism. Nature 349, 117-27 (1991). WholeCell: PUB_0689, PubMed: 1898771

  3. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Hase Y, Yokoyama S, Muto A, Himeno H. Removal of a ribosome small subunit-dependent GTPase confers salt resistance on Escherichia coli cells. RNA 15, 1766-74 (2009). WholeCell: PUB_0101, PubMed: 19620234

  6. ... 2 more

  7. Kimura T, Takagi K, Hirata Y, Hase Y, Muto A, Himeno H. Ribosome-small-subunit-dependent GTPase interacts with tRNA-binding sites on the ribosome. J Mol Biol 381, 467-77 (2008). WholeCell: PUB_0102, PubMed: 18588897

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:14
Last updated 2012-10-01 15:12:54