MG_108 – Ser/Thr protein phosphatase 2C, putative

Name
WID MG_108 View in model
Name Ser/Thr protein phosphatase 2C, putative View in model
Symbol ptc1
Protein product MG_108_MONOMER
Cross references GenBank: AAC71326.1, CMR: MG_108, BioCyc: MG_108, SwissProt: P47354
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 132838138621 MG_104 MG_105 MG_106 MG_107 MG_108 MG_109 MG_110 MG_111 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 135338 (nt), Length: 783 (nt), Direction: Forward, G/C content: 29.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
ATGCAAGCTGCTAATGATCATTTCTTTACCGGTTTATCAAAAAAAGGTCC
TGTAAGAAAGGAAAATCAGGACTTTTATGGATTTAGTTTTAATCAAAATA
ACCTACTAATAGTTGTTTGTGATGGTCTTGGTGGTTATAAGGGTGGCAAG
ATTGCTAGTAACTTAGTAGGTAAACTCTTTCTTAGTTTATTTGAAGGTTT
TGAATTTAACCAGTGAGATGAAACTACAGTTAAAAAGTGGTTTGAAAATA
CTTTAATACAAGCACGCTTTCAACTAGAAAATTGTTTTCAAACAGTTTAT
GAAGCACAAATCCAGTTTGCTAGGATGGCTAGCACCTTGGTCTTGGGAAT
TTTAACTAAAAGTGATATTTATATCTTTTGAATTGGTGATTCCAGAGCTT
ACTTATTATTTGAAAACCAAGCTAAGTTAGTTACTAAGGATCACAATCTT
TATAACCAGTTAGTTGCTATGAATGCTGATGAGAAATTACTTTTAAGTTA
TTCTAATCAACTTTTAGCATTAACAAATACTATTTCCAAAGAAACAAAAA
GACCATTAGTTTATGGTTTTTATAACACAAAAATTGAACAACAAGAATTT
TTATTATTGTGTTCTGATGGACTTTATAACTTTGTTGAAAAAGAGCTTTT
TTTTGAAATTATCACTAATTCTAAAAACCTAAAACAAGCAGTGTTTAATC
TTTATAGAAAAAGTATTGAAAATGCAAGTAATGATAATATTACTGCTGCC
CTTGTTAATCTGCAAAAATGGAAGCAATCTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
783
View in model
Transcription unit TU_068 View in model
Empirical formula (pH 7.5) H8338C7554N3087O5480P783
Molecular weight (pH 7.5; Da) 254300.58 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8126400
pI 4.16
 
Comments
Comments Located next to protein kinase MG_109;
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:14
Last updated 2012-10-01 15:12:54