MG_105 – putative DNA integrity scanning protein

Name
WID MG_105 View in model
Name putative DNA integrity scanning protein View in model
Symbol disA
Protein product MG_105_MONOMER
Cross references GenBank: AAC71323.1, CMR: MG_105, BioCyc: MG_105, SwissProt: P47351
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 131070136673 MG_104 MG_105 MG_106 MG_107 MG_108 MG_109 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 133570 (nt), Length: 603 (nt), Direction: Forward, G/C content: 31.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGTTGTTAATATCCTGCTTTTTATTACCCTTATTTTTTTACTTTTACT
GTTTGTTTTTTTAATTGCTTTTGCATTTCTAAACAAACGGGTTAGAAATT
ATGTTGTACGTACTTGAACTAGTGTTTTCAGTAAGTCCAAACAAAACCTT
GATAAAAAGAACTTTTTTGACAATTTAACTTCAACTTTATTAAGACTTTC
AGTTGATAAAATTGGGGCTATTATTGCCATTGAAAAACGTGATTCACTTG
ATCCTTATATCAACATTGGTTATCGGGTTAGTTCTGATTTTTCCCCTGAA
CTGTTAGTTACTATTTTTTACAACAAATCATCTCCTTTACATGATGGAGC
GGTGATTGTTAGAGATTACAAAATTATTAGTGTCTCTTCTTACTTTCCAA
TGACAAGACAATTAATTGATGTTTCATATGGTTCAAGACACAGAAGTGCC
TTGGGATTAAGTGAAAAGTCTGATGCAGTTGTTTTTATTGTTAGTGAAAC
AACTGGTAAAATATCAGTTGCTTTAAAAGGGGTTATTAAAACCTTGTCTT
CCAACTCAGATAGGTTGCAAGATGAAATTATCCATTACTTGTCTTCAAAG
TAG
50
100
150
200
250
300
350
400
450
500
550
600
603
View in model
Transcription unit TU_066 View in model
Empirical formula (pH 7.5) H6397C5793N2304O4280P603
Molecular weight (pH 7.5; Da) 195451.59 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6136500
pI 4.72
 
Comments
Comments DNA integrity checkpoint protein [PUB_0110]. In B. subtilis binds to damaged DNA and inhibits phosphorylation of the sporulation transcriptional regulator Spo0A thereby delaying sporulation [PUB_0511]. Recognizes strand breaks, base damage, and cross links, possibly through ssDNA, holiday junctions, or stalled replication forks that are generated during recombination repair of these lesions [PUB_0511, PUB_0512]. The rest of the B. subtilis signaling system (spo0A, kinA, kinE) is not present in M. genitalium. Has diadenylate cyclization activity which is abolished when bound to branched DNA such as holiday junctions [PUB_0195, PUB_0512]. Produces c-di-AMP from 2 ATPs [PUB_0512]. c-di-AMP may act as second messenger, similar to c-di-GMP to regulate Spo0A [PUB_0512]. Forms octamers [PUB_0512], and is sorted to mother cell during division [PUB_0511]. disA deletion has no effect on cell division, sporulation, competence, or the response of vegetative cells to DNA damage [PUB_0513].
References
  1. Bejerano-Sagie M, Oppenheimer-Shaanan Y, Berlatzky I, Rouvinski A, Meyerovich M, Ben-Yehuda S. A checkpoint protein that scans the chromosome for damage at the start of sporulation in Bacillus subtilis. Cell 125, 679-90 (2006). WholeCell: PUB_0513, PubMed: 16713562

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Boye E. DisA, a busy bee that monitors chromosome integrity. Cell 125, 641-3 (2006). WholeCell: PUB_0511, PubMed: 16713555

  4. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 3 more

  7. Römling U. Great times for small molecules: c-di-AMP, a second messenger candidate in Bacteria and Archaea. Sci Signal 1, pe39 (2008). WholeCell: PUB_0195, PubMed: 18714086

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  9. Witte G, Hartung S, Büttner K, Hopfner KP. Structural biochemistry of a bacterial checkpoint protein reveals diadenylate cyclase activity regulated by DNA recombination intermediates. Mol Cell 30, 167-78 (2008). WholeCell: PUB_0512, PubMed: 18439896

 
Metadata
Created 2012-10-01 15:07:14
Last updated 2012-10-01 15:12:53