MG_101 – Uncharacterized HTH-type transcriptional regulator

Name
WID MG_101 View in model
Name Uncharacterized HTH-type transcriptional regulator View in model
Symbol gntR
Protein product MG_101_MONOMER
Cross references GenBank: AAC71319.1, CMR: MG_101, BioCyc: MG_101, SwissProt: P47347
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 126187131856 MG_099 MG_100 MG_101 MG_102 MG_103 MG_104 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 128687 (nt), Length: 669 (nt), Direction: Forward, G/C content: 33.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGAAGTTCGGGAAAGAGATAGCTAAAAAAAATCAAATTATTTATCGCTA
TATAATCCTTAAAATTCAAAGCTTTGAATGACCTGCTAACACCCGTATCT
TCTCAGAACGCCAACTAGAAATCCGTTTCAACTCCTCACGGAGTCAAATT
CGCTCTGTTCTCGCTACGCTTTTAAACAAAAATATAATCCGCTACACTAA
AAATACCCCTGGTTATTTTGTGTGTAAAGATGTAGGCTTTAGTTTTTTTC
ATAAAACCCAGGATAATCTGAAGGTGAAATATGCTAAACTTTCAACTTTG
ATTAAAAAGCTGTTATCACAGGATGATGCTAGTGTTTTTGCCAATATTGA
CAGTACTGTGCACCTTGATAAATTTAAGGGAATTGAAGCTAAGTTTTTTG
ATGAGAATAAAAAACACTTTTTAAACGTTTGTTTTTTTGCTAAAGATGAT
ATTTTAAACATCCTTGATGAAAACAACCTCCAGCAACAGTTCTTCAGGGA
GTTTGCTTACAATGGGATTGCTATTGAAAAACGTCATTGTGTTACCTCTG
TTGACAAGGAAAGTGGGTGCTTGGTGATGTATGACATGTATTATGATGAC
AATGATAATTTTGTAGTTGCTAGCAAAAGTAACTTCCTTAACCCTGAATT
GAAAGTAATCAATGCTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
669
View in model
Transcription unit TU_063 View in model
Empirical formula (pH 7.5) H7140C6470N2685O4681P669
Molecular weight (pH 7.5; Da) 218128.29 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
6820000
pI 4.06
 
Comments
Comments HTH-type transcriptional regulator [PUB_0096]; many of family are autoregulatory [PUB_0110]; regulates gluconate metabolism [PUB_0196];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Peekhaus N, Conway T. Positive and negative transcriptional regulation of the Escherichia coli gluconate regulon gene gntT by GntR and the cyclic AMP (cAMP)-cAMP receptor protein complex. J Bacteriol 180, 1777-85 (1998). WholeCell: PUB_0196, PubMed: 9537375

  5. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:14
Last updated 2012-10-01 15:12:53