MG_093 – ribosomal protein L9

Name
WID MG_093 View in model
Name ribosomal protein L9 View in model
Symbol rplI
Protein product MG_093_MONOMER
Cross references GenBank: AAC71311.1, BioCyc: MG_093, CMR: MG_093, SwissProt: P47339
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 115845121298 MG_089 MG_090 MG_091 MG_092 MG_093 MG_094 MG_095 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 118345 (nt), Length: 453 (nt), Direction: Forward, G/C content: 32.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAAGATAATTTTGAAGCAAGATGTTGCTAAATTAGGCAAGCGGTTTGA
TGTTGTTGAAGTTAAAGATGGGTTTGCTATCCATTTTTTATTTCCCAAAA
AACTAGCTGCACCTTTAACAAAGAAAGCAATTGCTAACCGTGATTTGTTT
TTAAAACAACAACAAGAACAATACCAAAAAAATCGTGCCTTAGCTGAAAA
ATTGAAACTAGTAATTGAACAAACACCATTAACTTTTCAACTCAAACAAC
ACGATGGCAAGCCATATGGTTCAATCATCACCAAACAAATAATTAATTTA
GCAAAACAACAAAGACTTGATTTACAGCGCTTTATGTTTAAAGATAATGT
GCGCTTACAGTTTGGTGAACACAAACTAATTTTGCACCTTTTTGAGGAGA
TAACTGCAACTTTAACTGTTATAGTGAACCCTGAAAATGGGACAACAAAC
TAG
50
100
150
200
250
300
350
400
450
453
View in model
Transcription unit TU_059 View in model
Empirical formula (pH 7.5) H4854C4400N1875O3128P453
Molecular weight (pH 7.5; Da) 148079.24 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.6 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4650600
pI 3.74
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:14
Last updated 2012-10-01 15:12:51